Mutagenetix > Incidental Mutation

Incidental Mutation 'R0613:Map1b'

54911

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

MMRRC Submission

038802-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0613 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 99441641 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 168 (D168V)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762] [ENSMUST00000223725]

AlphaFold

P14873

Predicted Effect

probably damaging
Transcript: ENSMUST00000064762
AA Change: D168V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: D168V

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223693

Predicted Effect

probably damaging
Transcript: ENSMUST00000223725
AA Change: D42V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224605

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224702

Meta Mutation Damage Score

0.8375

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.3%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acd	A	T	8: 105,700,568		probably null	Het
Adcy9	A	G	16: 4,419,539	S3P	probably damaging	Het
Adgrl4	T	C	3: 151,543,222		probably benign	Het
Aff3	T	C	1: 38,209,923	E700G	probably benign	Het
Ahctf1	A	G	1: 179,769,414	S56P	probably damaging	Het
Atp12a	T	A	14: 56,374,521	I384N	probably damaging	Het
Brca1	A	T	11: 101,508,210	S1519T	probably benign	Het
Ccl25	T	C	8: 4,349,850	V94A	probably benign	Het
Cep170	T	C	1: 176,774,680	T287A	probably benign	Het
Ces1a	A	G	8: 93,025,581	S383P	probably benign	Het
Cntnap3	A	T	13: 64,758,414	F793I	probably damaging	Het
Ctsm	T	C	13: 61,539,682	R89G	probably damaging	Het
Cyp2j12	T	G	4: 96,102,079	T417P	probably damaging	Het
D430041D05Rik	G	C	2: 104,167,950	P1836R	probably damaging	Het
Edn2	T	A	4: 120,161,864		probably null	Het
Emc1	T	A	4: 139,375,072		probably benign	Het
Fam189a2	T	A	19: 23,986,489	N239Y	probably damaging	Het
Fras1	T	C	5: 96,700,488		probably benign	Het
Fsip2	A	T	2: 82,993,795	D6624V	probably damaging	Het
Gpr107	A	G	2: 31,178,285	Y253C	probably damaging	Het
Gpr108	A	G	17: 57,238,174		probably benign	Het
Grik1	A	G	16: 88,051,333		probably null	Het
Gtf3c1	G	A	7: 125,644,134	P1766L	possibly damaging	Het
Gucy2c	A	T	6: 136,760,723	N293K	probably damaging	Het
Hps6	C	A	19: 46,003,821	P66T	probably benign	Het
Hspa9	A	T	18: 34,947,980	V216E	probably damaging	Het
Igsf8	T	A	1: 172,317,589	M224K	probably benign	Het
Igsf9b	T	C	9: 27,326,920	V569A	probably damaging	Het
Itgb4	A	T	11: 115,993,342	I952F	probably damaging	Het
Kcnh4	C	T	11: 100,746,932	G633E	probably benign	Het
Khdrbs2	A	G	1: 32,657,522	H344R	possibly damaging	Het
Kmo	C	A	1: 175,637,892	R71S	probably damaging	Het
Lrrc31	A	G	3: 30,685,035		probably benign	Het
Mfsd6	T	C	1: 52,658,696		probably benign	Het
Mgst1	G	A	6: 138,156,245	G186D	probably damaging	Het
Mrc1	C	T	2: 14,294,819	A740V	probably damaging	Het
Mroh2a	G	A	1: 88,243,950	R770Q	probably damaging	Het
Mtor	T	C	4: 148,526,046	Y1605H	possibly damaging	Het
Ncoa4	T	A	14: 32,176,552	L443Q	probably damaging	Het
Nelfa	G	A	5: 33,903,463		probably benign	Het
Nepn	T	A	10: 52,401,257	L363Q	probably damaging	Het
Nfat5	A	G	8: 107,366,295	T630A	possibly damaging	Het
Nipal4	A	T	11: 46,150,384	V328E	probably benign	Het
Olfr1228	A	T	2: 89,249,125	C178S	probably damaging	Het
Olfr1391	T	A	11: 49,327,748	S112R	possibly damaging	Het
Olfr462	A	T	11: 87,889,227	V223E	possibly damaging	Het
Olfr747	T	A	14: 50,681,404	I77F	probably benign	Het
Olfr809	T	A	10: 129,776,262	M116K	probably damaging	Het
Olfr924	T	A	9: 38,848,613	C166*	probably null	Het
Otogl	A	T	10: 107,817,070	N1140K	probably damaging	Het
Ppip5k2	A	C	1: 97,752,740	Y236*	probably null	Het
Prelid1	C	T	13: 55,324,343	R111*	probably null	Het
Prpf8	T	C	11: 75,503,444	L1771P	probably damaging	Het
Ptprb	A	T	10: 116,302,325	Y378F	possibly damaging	Het
Ptprb	A	G	10: 116,302,378	T396A	possibly damaging	Het
Rab3il1	T	C	19: 10,028,364	L174P	probably damaging	Het
Rab4a	T	C	8: 123,823,835	V18A	possibly damaging	Het
Scn3a	T	A	2: 65,472,284	M1273L	possibly damaging	Het
Sdhc	A	T	1: 171,129,844	V156E	probably benign	Het
Slco3a1	T	C	7: 74,346,634		probably benign	Het
Syne3	T	C	12: 104,958,112	T343A	probably benign	Het
Syt11	A	G	3: 88,762,469	C39R	probably damaging	Het
Tll2	G	T	19: 41,104,990	D462E	probably damaging	Het
Tmem132e	T	A	11: 82,438,338	V481D	probably damaging	Het
Tmem161b	C	T	13: 84,251,320	L17F	probably damaging	Het
Vmn2r105	T	A	17: 20,208,316	I833F	probably damaging	Het
Vstm2a	A	T	11: 16,263,140	N175I	probably damaging	Het
Xpnpep1	G	T	19: 53,006,353	D238E	probably damaging	Het
Zfp112	G	A	7: 24,127,028	G807D	probably benign	Het
Zfp518b	A	T	5: 38,673,603	V353E	probably damaging	Het
Zfp69	T	C	4: 120,934,347	E39G	probably benign	Het
Zfp865	A	G	7: 5,029,091	H25R	possibly damaging	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- ATGGTCCTTCCCAGTACACGACAC -3'
(R):5'- TGGCAGTAAGCTTCAGGCACAG -3'

Sequencing Primer
(F):5'- CCTGCTGAAGTCCAAGAGATCTG -3'
(R):5'- GCTTCAGGCACAGTCATAGTG -3'

Posted On

2013-07-11