Incidental Mutation 'R7074:Prkar2b'
ID549114
Institutional Source Beutler Lab
Gene Symbol Prkar2b
Ensembl Gene ENSMUSG00000002997
Gene Nameprotein kinase, cAMP dependent regulatory, type II beta
SynonymsRII(beta), Pkarb2, PKARIIbeta
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.533) question?
Stock #R7074 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location31958476-32061296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31972148 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 213 (Y213H)
Ref Sequence ENSEMBL: ENSMUSP00000003079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003079] [ENSMUST00000036497] [ENSMUST00000146865]
PDB Structure
Structure and Allostery of the PKA RIIb Tetrameric Holoenzyme [X-RAY DIFFRACTION]
Structure and Allostery of the PKA RIIb Tetrameric Holoenzyme [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000003079
AA Change: Y213H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003079
Gene: ENSMUSG00000002997
AA Change: Y213H

DomainStartEndE-ValueType
RIIa 7 44 7.78e-17 SMART
low complexity region 61 68 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
cNMP 152 272 7.2e-26 SMART
cNMP 274 398 8.53e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000036497
AA Change: Y213H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039797
Gene: ENSMUSG00000002997
AA Change: Y213H

DomainStartEndE-ValueType
RIIa 7 44 7.78e-17 SMART
low complexity region 61 68 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
cNMP 152 272 7.2e-26 SMART
cNMP 274 398 8.53e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146865
AA Change: Y53H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135290
Gene: ENSMUSG00000002997
AA Change: Y53H

DomainStartEndE-ValueType
cNMP 1 112 1.33e-15 SMART
cNMP 114 238 8.53e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. This subunit has been shown to interact with and suppress the transcriptional activity of the cAMP responsive element binding protein 1 (CREB1) in activated T cells. Knockout studies in mice suggest that this subunit may play an important role in regulating energy balance and adiposity. The studies also suggest that this subunit may mediate the gene induction and cataleptic behavior induced by haloperidol. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygou null mice are lean, weigh less than controls, and have reduced white fat pad size. Mice are resistant to both diet-induced obesity and to diet-induced insulin resistance. Mice show impaired coordination and increased sensitivity to chronic amphetamine exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A T 4: 144,613,863 I53L probably benign Het
Acss2 T C 2: 155,522,041 L80P possibly damaging Het
Adam3 A T 8: 24,694,347 F546I probably benign Het
Adtrp A T 13: 41,828,141 probably null Het
Anapc1 G T 2: 128,678,274 P208T probably damaging Het
Ankrd33 A G 15: 101,119,549 K281R probably benign Het
Bcl11b A G 12: 107,989,507 S128P probably benign Het
Ccdc57 T C 11: 120,903,374 K265E possibly damaging Het
Cep72 A G 13: 74,051,580 C244R probably benign Het
Cope A G 8: 70,312,887 Q303R probably benign Het
Cpd T A 11: 76,813,594 N398I probably damaging Het
Cplx1 C T 5: 108,548,527 probably null Het
Dixdc1 T A 9: 50,689,914 E344D possibly damaging Het
Dock7 A T 4: 98,945,208 F1951I unknown Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Faap24 A T 7: 35,395,102 I91K possibly damaging Het
Fubp3 T C 2: 31,595,294 S107P probably damaging Het
Gas2l2 T A 11: 83,423,067 Q473L probably benign Het
Ghr A T 15: 3,333,391 Y200N probably damaging Het
Gm4950 G A 18: 51,865,449 Q145* probably null Het
Gm826 C T 2: 160,311,890 V78I unknown Het
Gnas G A 2: 174,285,049 E126K probably damaging Het
Grip2 A T 6: 91,784,708 V235E probably benign Het
Hmgcl A G 4: 135,953,867 H88R probably benign Het
Htr7 A G 19: 36,056,883 V124A probably damaging Het
Igf2r T A 17: 12,714,116 I840F possibly damaging Het
Ints8 T C 4: 11,204,574 I961V possibly damaging Het
Jmy A T 13: 93,453,931 S555T probably benign Het
Klk1b27 G A 7: 44,056,553 G227S probably damaging Het
Lao1 A C 4: 118,968,185 T401P probably damaging Het
Lrwd1 C T 5: 136,123,657 V547I probably benign Het
Mttp C A 3: 138,107,273 R532L possibly damaging Het
Muc16 T C 9: 18,655,650 T1858A unknown Het
Myo18a T A 11: 77,842,561 D1409E probably benign Het
Ncor2 T A 5: 125,049,366 R554* probably null Het
Olfr127 T A 17: 37,903,827 Y94N possibly damaging Het
Olfr168 T A 16: 19,530,105 I272F possibly damaging Het
Olfr222 T C 11: 59,571,009 T244A probably damaging Het
Olfr22-ps1 A T 11: 73,955,149 H153L probably benign Het
Olfr690 A G 7: 105,329,268 M308T probably benign Het
Prkd3 T A 17: 78,974,807 K306* probably null Het
Psd2 A G 18: 36,010,684 E681G probably benign Het
Sel1l2 T A 2: 140,263,442 N276I probably damaging Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Smyd1 A G 6: 71,237,375 V214A probably damaging Het
Spag5 T C 11: 78,305,042 probably null Het
Trem3 C T 17: 48,249,881 R127W probably damaging Het
Ttn G A 2: 76,918,081 T4208I probably benign Het
Tubgcp6 A G 15: 89,120,636 F260S probably damaging Het
Vmn1r51 A T 6: 90,129,672 D190V probably benign Het
Zc3h14 A G 12: 98,758,600 I174V possibly damaging Het
Zfp423 G A 8: 87,782,432 T428I probably benign Het
Zfp608 T A 18: 54,897,382 N1162I possibly damaging Het
Zmym5 T C 14: 56,804,798 M8V probably benign Het
Other mutations in Prkar2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Prkar2b APN 12 32061072 missense possibly damaging 0.55
IGL02056:Prkar2b APN 12 31975910 splice site probably benign
IGL02071:Prkar2b APN 12 31963017 missense probably damaging 1.00
IGL02118:Prkar2b APN 12 31975964 missense probably damaging 1.00
spark UTSW 12 31987974 splice site probably null
R0211:Prkar2b UTSW 12 31972184 missense probably benign 0.30
R0362:Prkar2b UTSW 12 31987974 splice site probably null
R0485:Prkar2b UTSW 12 31976035 splice site probably benign
R0898:Prkar2b UTSW 12 31963002 missense possibly damaging 0.90
R1426:Prkar2b UTSW 12 31962988 splice site probably benign
R1997:Prkar2b UTSW 12 31963935 missense probably damaging 0.99
R2114:Prkar2b UTSW 12 31967280 missense probably damaging 1.00
R2346:Prkar2b UTSW 12 31972150 missense probably benign 0.01
R2513:Prkar2b UTSW 12 31975929 missense possibly damaging 0.93
R3875:Prkar2b UTSW 12 31965123 missense probably benign 0.01
R5301:Prkar2b UTSW 12 31975928 missense probably damaging 1.00
R5316:Prkar2b UTSW 12 32060985 missense probably damaging 0.97
R5351:Prkar2b UTSW 12 31972127 missense probably damaging 1.00
R6025:Prkar2b UTSW 12 32060856 missense possibly damaging 0.68
R6028:Prkar2b UTSW 12 31993758 missense possibly damaging 0.50
R6563:Prkar2b UTSW 12 31993786 splice site probably null
R7431:Prkar2b UTSW 12 31963151 splice site probably null
R7747:Prkar2b UTSW 12 32060938 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CGAATGCCAATGACTTGTGATC -3'
(R):5'- ATCAAGATTGCATTGCACGG -3'

Sequencing Primer
(F):5'- ACAGACTGGGGATATCTGCCTATC -3'
(R):5'- ACGGGGCTCTTCTCTGAAG -3'
Posted On2019-05-15