Incidental Mutation 'R7074:Ankrd33'
ID549124
Institutional Source Beutler Lab
Gene Symbol Ankrd33
Ensembl Gene ENSMUSG00000047034
Gene Nameankyrin repeat domain 33
SynonymsPanky, A930021G21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R7074 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location101115755-101120040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101119549 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 281 (K281R)
Ref Sequence ENSEMBL: ENSMUSP00000067028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070875] [ENSMUST00000229263] [ENSMUST00000229842] [ENSMUST00000229930] [ENSMUST00000229954] [ENSMUST00000231158]
Predicted Effect probably benign
Transcript: ENSMUST00000070875
AA Change: K281R

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000067028
Gene: ENSMUSG00000047034
AA Change: K281R

DomainStartEndE-ValueType
ANK 5 35 1.19e3 SMART
ANK 39 68 9.13e-4 SMART
ANK 74 103 1.9e-1 SMART
ANK 108 137 4.88e2 SMART
low complexity region 149 171 N/A INTRINSIC
Blast:ANK 184 207 5e-6 BLAST
low complexity region 237 254 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229263
Predicted Effect probably benign
Transcript: ENSMUST00000229842
Predicted Effect probably benign
Transcript: ENSMUST00000229930
Predicted Effect unknown
Transcript: ENSMUST00000229954
AA Change: K329R
Predicted Effect probably benign
Transcript: ENSMUST00000231158
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A T 4: 144,613,863 I53L probably benign Het
Acss2 T C 2: 155,522,041 L80P possibly damaging Het
Adam3 A T 8: 24,694,347 F546I probably benign Het
Adtrp A T 13: 41,828,141 probably null Het
Anapc1 G T 2: 128,678,274 P208T probably damaging Het
Bcl11b A G 12: 107,989,507 S128P probably benign Het
Ccdc57 T C 11: 120,903,374 K265E possibly damaging Het
Cep72 A G 13: 74,051,580 C244R probably benign Het
Cope A G 8: 70,312,887 Q303R probably benign Het
Cpd T A 11: 76,813,594 N398I probably damaging Het
Cplx1 C T 5: 108,548,527 probably null Het
Dixdc1 T A 9: 50,689,914 E344D possibly damaging Het
Dock7 A T 4: 98,945,208 F1951I unknown Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Faap24 A T 7: 35,395,102 I91K possibly damaging Het
Fubp3 T C 2: 31,595,294 S107P probably damaging Het
Gas2l2 T A 11: 83,423,067 Q473L probably benign Het
Ghr A T 15: 3,333,391 Y200N probably damaging Het
Gm4950 G A 18: 51,865,449 Q145* probably null Het
Gm826 C T 2: 160,311,890 V78I unknown Het
Gnas G A 2: 174,285,049 E126K probably damaging Het
Grip2 A T 6: 91,784,708 V235E probably benign Het
Hmgcl A G 4: 135,953,867 H88R probably benign Het
Htr7 A G 19: 36,056,883 V124A probably damaging Het
Igf2r T A 17: 12,714,116 I840F possibly damaging Het
Ints8 T C 4: 11,204,574 I961V possibly damaging Het
Jmy A T 13: 93,453,931 S555T probably benign Het
Klk1b27 G A 7: 44,056,553 G227S probably damaging Het
Lao1 A C 4: 118,968,185 T401P probably damaging Het
Lrwd1 C T 5: 136,123,657 V547I probably benign Het
Mttp C A 3: 138,107,273 R532L possibly damaging Het
Muc16 T C 9: 18,655,650 T1858A unknown Het
Myo18a T A 11: 77,842,561 D1409E probably benign Het
Ncor2 T A 5: 125,049,366 R554* probably null Het
Olfr127 T A 17: 37,903,827 Y94N possibly damaging Het
Olfr168 T A 16: 19,530,105 I272F possibly damaging Het
Olfr222 T C 11: 59,571,009 T244A probably damaging Het
Olfr22-ps1 A T 11: 73,955,149 H153L probably benign Het
Olfr690 A G 7: 105,329,268 M308T probably benign Het
Prkar2b A G 12: 31,972,148 Y213H probably damaging Het
Prkd3 T A 17: 78,974,807 K306* probably null Het
Psd2 A G 18: 36,010,684 E681G probably benign Het
Sel1l2 T A 2: 140,263,442 N276I probably damaging Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Smyd1 A G 6: 71,237,375 V214A probably damaging Het
Spag5 T C 11: 78,305,042 probably null Het
Trem3 C T 17: 48,249,881 R127W probably damaging Het
Ttn G A 2: 76,918,081 T4208I probably benign Het
Tubgcp6 A G 15: 89,120,636 F260S probably damaging Het
Vmn1r51 A T 6: 90,129,672 D190V probably benign Het
Zc3h14 A G 12: 98,758,600 I174V possibly damaging Het
Zfp423 G A 8: 87,782,432 T428I probably benign Het
Zfp608 T A 18: 54,897,382 N1162I possibly damaging Het
Zmym5 T C 14: 56,804,798 M8V probably benign Het
Other mutations in Ankrd33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Ankrd33 APN 15 101116959 missense probably damaging 1.00
IGL02458:Ankrd33 APN 15 101116607 missense probably damaging 1.00
R1830:Ankrd33 UTSW 15 101119551 missense probably damaging 1.00
R2072:Ankrd33 UTSW 15 101119636 missense probably benign 0.10
R6028:Ankrd33 UTSW 15 101119072 missense probably damaging 1.00
R6904:Ankrd33 UTSW 15 101117112 intron probably null
R7022:Ankrd33 UTSW 15 101116899 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GCACTAGAGGCAAATCAGTGC -3'
(R):5'- AACCGTGTATACTTGGTGGGAG -3'

Sequencing Primer
(F):5'- CAGTGCCAGAACTTTTAGGTACTGC -3'
(R):5'- TTCCCGCTGGCAGAGATAG -3'
Posted On2019-05-15