Incidental Mutation 'R7074:Olfr127'
ID549127
Institutional Source Beutler Lab
Gene Symbol Olfr127
Ensembl Gene ENSMUSG00000058114
Gene Nameolfactory receptor 127
SynonymsMOR218-7, GA_x6K02T2PSCP-2354126-2355093
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7074 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location37900437-37906795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37903827 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 94 (Y94N)
Ref Sequence ENSEMBL: ENSMUSP00000149133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076331] [ENSMUST00000217223]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076331
AA Change: Y94N

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075669
Gene: ENSMUSG00000058114
AA Change: Y94N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.7e-46 PFAM
Pfam:7tm_1 41 290 1.4e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217223
AA Change: Y94N

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A T 4: 144,613,863 I53L probably benign Het
Acss2 T C 2: 155,522,041 L80P possibly damaging Het
Adam3 A T 8: 24,694,347 F546I probably benign Het
Adtrp A T 13: 41,828,141 probably null Het
Anapc1 G T 2: 128,678,274 P208T probably damaging Het
Ankrd33 A G 15: 101,119,549 K281R probably benign Het
Bcl11b A G 12: 107,989,507 S128P probably benign Het
Ccdc57 T C 11: 120,903,374 K265E possibly damaging Het
Cep72 A G 13: 74,051,580 C244R probably benign Het
Cope A G 8: 70,312,887 Q303R probably benign Het
Cpd T A 11: 76,813,594 N398I probably damaging Het
Cplx1 C T 5: 108,548,527 probably null Het
Dixdc1 T A 9: 50,689,914 E344D possibly damaging Het
Dock7 A T 4: 98,945,208 F1951I unknown Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Faap24 A T 7: 35,395,102 I91K possibly damaging Het
Fubp3 T C 2: 31,595,294 S107P probably damaging Het
Gas2l2 T A 11: 83,423,067 Q473L probably benign Het
Ghr A T 15: 3,333,391 Y200N probably damaging Het
Gm4950 G A 18: 51,865,449 Q145* probably null Het
Gm826 C T 2: 160,311,890 V78I unknown Het
Gnas G A 2: 174,285,049 E126K probably damaging Het
Grip2 A T 6: 91,784,708 V235E probably benign Het
Hmgcl A G 4: 135,953,867 H88R probably benign Het
Htr7 A G 19: 36,056,883 V124A probably damaging Het
Igf2r T A 17: 12,714,116 I840F possibly damaging Het
Ints8 T C 4: 11,204,574 I961V possibly damaging Het
Jmy A T 13: 93,453,931 S555T probably benign Het
Klk1b27 G A 7: 44,056,553 G227S probably damaging Het
Lao1 A C 4: 118,968,185 T401P probably damaging Het
Lrwd1 C T 5: 136,123,657 V547I probably benign Het
Mttp C A 3: 138,107,273 R532L possibly damaging Het
Muc16 T C 9: 18,655,650 T1858A unknown Het
Myo18a T A 11: 77,842,561 D1409E probably benign Het
Ncor2 T A 5: 125,049,366 R554* probably null Het
Olfr168 T A 16: 19,530,105 I272F possibly damaging Het
Olfr222 T C 11: 59,571,009 T244A probably damaging Het
Olfr22-ps1 A T 11: 73,955,149 H153L probably benign Het
Olfr690 A G 7: 105,329,268 M308T probably benign Het
Prkar2b A G 12: 31,972,148 Y213H probably damaging Het
Prkd3 T A 17: 78,974,807 K306* probably null Het
Psd2 A G 18: 36,010,684 E681G probably benign Het
Sel1l2 T A 2: 140,263,442 N276I probably damaging Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Smyd1 A G 6: 71,237,375 V214A probably damaging Het
Spag5 T C 11: 78,305,042 probably null Het
Trem3 C T 17: 48,249,881 R127W probably damaging Het
Ttn G A 2: 76,918,081 T4208I probably benign Het
Tubgcp6 A G 15: 89,120,636 F260S probably damaging Het
Vmn1r51 A T 6: 90,129,672 D190V probably benign Het
Zc3h14 A G 12: 98,758,600 I174V possibly damaging Het
Zfp423 G A 8: 87,782,432 T428I probably benign Het
Zfp608 T A 18: 54,897,382 N1162I possibly damaging Het
Zmym5 T C 14: 56,804,798 M8V probably benign Het
Other mutations in Olfr127
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Olfr127 APN 17 37904257 missense probably damaging 0.98
IGL00981:Olfr127 APN 17 37904181 missense probably benign 0.03
IGL02271:Olfr127 APN 17 37904243 missense probably benign 0.22
IGL02409:Olfr127 APN 17 37903788 missense probably damaging 0.99
R1649:Olfr127 UTSW 17 37904169 missense probably benign 0.09
R1808:Olfr127 UTSW 17 37903770 missense probably damaging 1.00
R2360:Olfr127 UTSW 17 37904454 missense possibly damaging 0.94
R3808:Olfr127 UTSW 17 37903573 missense probably benign 0.00
R3809:Olfr127 UTSW 17 37903573 missense probably benign 0.00
R3953:Olfr127 UTSW 17 37903609 missense probably benign 0.00
R3955:Olfr127 UTSW 17 37903609 missense probably benign 0.00
R3957:Olfr127 UTSW 17 37903609 missense probably benign 0.00
R4683:Olfr127 UTSW 17 37904148 missense probably benign
R5430:Olfr127 UTSW 17 37904413 missense probably damaging 1.00
R5716:Olfr127 UTSW 17 37903828 missense probably benign 0.00
R5866:Olfr127 UTSW 17 37903809 nonsense probably null
R7238:Olfr127 UTSW 17 37904437 missense probably benign 0.37
R8098:Olfr127 UTSW 17 37904359 missense probably damaging 1.00
X0021:Olfr127 UTSW 17 37903756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAGATCTTACAGGCTTTGC -3'
(R):5'- CCTGAGATACCTCCACTTAGCC -3'

Sequencing Primer
(F):5'- GTGACATACCTATTGGATTCAGCAGG -3'
(R):5'- TTAGCCACACAGCTGCC -3'
Posted On2019-05-15