Incidental Mutation 'R7074:Psd2'
ID549130
Institutional Source Beutler Lab
Gene Symbol Psd2
Ensembl Gene ENSMUSG00000024347
Gene Namepleckstrin and Sec7 domain containing 2
SynonymsEFA6C, 6330404E20Rik
MMRRC Submission
Accession Numbers

Genbank: NM_028707

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7074 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location35964830-36014715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36010684 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 681 (E681G)
Ref Sequence ENSEMBL: ENSMUSP00000135795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115716] [ENSMUST00000175734] [ENSMUST00000176472] [ENSMUST00000176873] [ENSMUST00000177432]
Predicted Effect probably benign
Transcript: ENSMUST00000115716
AA Change: E680G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000111381
Gene: ENSMUSG00000024347
AA Change: E680G

DomainStartEndE-ValueType
low complexity region 153 169 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Sec7 270 461 4.69e-56 SMART
PH 510 624 4.35e-14 SMART
Blast:Sec7 653 705 4e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000175734
AA Change: E681G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000135795
Gene: ENSMUSG00000024347
AA Change: E681G

DomainStartEndE-ValueType
low complexity region 153 169 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Sec7 270 462 4.1e-55 SMART
PH 511 625 1.9e-16 SMART
Blast:Sec7 654 706 4e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000176472
SMART Domains Protein: ENSMUSP00000135285
Gene: ENSMUSG00000024347

DomainStartEndE-ValueType
low complexity region 153 169 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Sec7 270 461 4.69e-56 SMART
Pfam:PH_9 511 553 4.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176873
AA Change: E681G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000135616
Gene: ENSMUSG00000024347
AA Change: E681G

DomainStartEndE-ValueType
low complexity region 153 169 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Sec7 270 462 4.2e-55 SMART
PH 511 625 1.9e-16 SMART
Blast:Sec7 654 706 4e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177432
AA Change: E677G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000135431
Gene: ENSMUSG00000024347
AA Change: E677G

DomainStartEndE-ValueType
low complexity region 153 169 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Sec7 270 461 4.69e-56 SMART
PH 510 621 5.36e-14 SMART
Blast:Sec7 650 702 4e-24 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A T 4: 144,613,863 I53L probably benign Het
Acss2 T C 2: 155,522,041 L80P possibly damaging Het
Adam3 A T 8: 24,694,347 F546I probably benign Het
Adtrp A T 13: 41,828,141 probably null Het
Anapc1 G T 2: 128,678,274 P208T probably damaging Het
Ankrd33 A G 15: 101,119,549 K281R probably benign Het
Bcl11b A G 12: 107,989,507 S128P probably benign Het
Ccdc57 T C 11: 120,903,374 K265E possibly damaging Het
Cep72 A G 13: 74,051,580 C244R probably benign Het
Cope A G 8: 70,312,887 Q303R probably benign Het
Cpd T A 11: 76,813,594 N398I probably damaging Het
Cplx1 C T 5: 108,548,527 probably null Het
Dixdc1 T A 9: 50,689,914 E344D possibly damaging Het
Dock7 A T 4: 98,945,208 F1951I unknown Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Faap24 A T 7: 35,395,102 I91K possibly damaging Het
Fubp3 T C 2: 31,595,294 S107P probably damaging Het
Gas2l2 T A 11: 83,423,067 Q473L probably benign Het
Ghr A T 15: 3,333,391 Y200N probably damaging Het
Gm4950 G A 18: 51,865,449 Q145* probably null Het
Gm826 C T 2: 160,311,890 V78I unknown Het
Gnas G A 2: 174,285,049 E126K probably damaging Het
Grip2 A T 6: 91,784,708 V235E probably benign Het
Hmgcl A G 4: 135,953,867 H88R probably benign Het
Htr7 A G 19: 36,056,883 V124A probably damaging Het
Igf2r T A 17: 12,714,116 I840F possibly damaging Het
Ints8 T C 4: 11,204,574 I961V possibly damaging Het
Jmy A T 13: 93,453,931 S555T probably benign Het
Klk1b27 G A 7: 44,056,553 G227S probably damaging Het
Lao1 A C 4: 118,968,185 T401P probably damaging Het
Lrwd1 C T 5: 136,123,657 V547I probably benign Het
Mttp C A 3: 138,107,273 R532L possibly damaging Het
Muc16 T C 9: 18,655,650 T1858A unknown Het
Myo18a T A 11: 77,842,561 D1409E probably benign Het
Ncor2 T A 5: 125,049,366 R554* probably null Het
Olfr127 T A 17: 37,903,827 Y94N possibly damaging Het
Olfr168 T A 16: 19,530,105 I272F possibly damaging Het
Olfr222 T C 11: 59,571,009 T244A probably damaging Het
Olfr22-ps1 A T 11: 73,955,149 H153L probably benign Het
Olfr690 A G 7: 105,329,268 M308T probably benign Het
Prkar2b A G 12: 31,972,148 Y213H probably damaging Het
Prkd3 T A 17: 78,974,807 K306* probably null Het
Sel1l2 T A 2: 140,263,442 N276I probably damaging Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Smyd1 A G 6: 71,237,375 V214A probably damaging Het
Spag5 T C 11: 78,305,042 probably null Het
Trem3 C T 17: 48,249,881 R127W probably damaging Het
Ttn G A 2: 76,918,081 T4208I probably benign Het
Tubgcp6 A G 15: 89,120,636 F260S probably damaging Het
Vmn1r51 A T 6: 90,129,672 D190V probably benign Het
Zc3h14 A G 12: 98,758,600 I174V possibly damaging Het
Zfp423 G A 8: 87,782,432 T428I probably benign Het
Zfp608 T A 18: 54,897,382 N1162I possibly damaging Het
Zmym5 T C 14: 56,804,798 M8V probably benign Het
Other mutations in Psd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Psd2 APN 18 35980335 missense probably benign 0.00
IGL01578:Psd2 APN 18 35979785 missense probably damaging 1.00
IGL02086:Psd2 APN 18 36005906 missense probably damaging 1.00
IGL02132:Psd2 APN 18 36004756 splice site probably benign
IGL02480:Psd2 APN 18 36006083 missense probably damaging 1.00
IGL02726:Psd2 APN 18 35987302 critical splice donor site probably null
3-1:Psd2 UTSW 18 35984401 missense probably damaging 1.00
R0103:Psd2 UTSW 18 36004717 missense probably damaging 1.00
R0103:Psd2 UTSW 18 36004717 missense probably damaging 1.00
R0320:Psd2 UTSW 18 35979644 missense probably damaging 1.00
R0573:Psd2 UTSW 18 35980493 splice site probably benign
R0685:Psd2 UTSW 18 36002991 missense possibly damaging 0.90
R0698:Psd2 UTSW 18 36012711 missense probably benign 0.22
R0730:Psd2 UTSW 18 35978574 missense possibly damaging 0.85
R0971:Psd2 UTSW 18 35979786 missense probably damaging 1.00
R1085:Psd2 UTSW 18 36012777 missense probably benign 0.10
R1535:Psd2 UTSW 18 36005790 missense probably benign 0.31
R2056:Psd2 UTSW 18 36006691 missense possibly damaging 0.60
R4011:Psd2 UTSW 18 35987247 missense probably benign 0.01
R4246:Psd2 UTSW 18 36006119 missense probably damaging 1.00
R4335:Psd2 UTSW 18 36007530 missense probably damaging 0.96
R4584:Psd2 UTSW 18 36012828 missense probably benign
R4942:Psd2 UTSW 18 35978664 missense probably damaging 1.00
R5120:Psd2 UTSW 18 35979810 missense possibly damaging 0.92
R5373:Psd2 UTSW 18 36007503 missense probably damaging 1.00
R5374:Psd2 UTSW 18 36007503 missense probably damaging 1.00
R5839:Psd2 UTSW 18 36007524 missense probably damaging 0.97
R6200:Psd2 UTSW 18 36006723 splice site probably null
R6925:Psd2 UTSW 18 35979711 missense probably damaging 1.00
R6967:Psd2 UTSW 18 35980332 missense probably damaging 0.97
R7142:Psd2 UTSW 18 35980044 missense possibly damaging 0.85
R7239:Psd2 UTSW 18 35980419 missense probably damaging 1.00
R7348:Psd2 UTSW 18 35980336 missense possibly damaging 0.85
R7581:Psd2 UTSW 18 35979997 missense probably benign 0.01
R7793:Psd2 UTSW 18 36002979 missense probably benign 0.37
R8221:Psd2 UTSW 18 35980425 missense probably damaging 0.99
R8310:Psd2 UTSW 18 35979713 missense probably damaging 1.00
X0065:Psd2 UTSW 18 36002942 missense possibly damaging 0.92
Z1177:Psd2 UTSW 18 35978280 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTTGGTGAAGCAGCTTCCGG -3'
(R):5'- AGGACACTGGCTTGGCTTAC -3'

Sequencing Primer
(F):5'- AAGCAGCTTCCGGTGTGG -3'
(R):5'- GGCAAGTCTCAAATTAGAGTCCCTG -3'
Posted On2019-05-15