Incidental Mutation 'R7075:Vmn1r1'
ID549136
Institutional Source Beutler Lab
Gene Symbol Vmn1r1
Ensembl Gene ENSMUSG00000091013
Gene Namevomeronasal 1 receptor 1
SynonymsGm6628
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R7075 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location182154704-182164486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 182158032 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 23 (F23I)
Ref Sequence ENSEMBL: ENSMUSP00000133035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169123] [ENSMUST00000227586] [ENSMUST00000227629]
Predicted Effect probably benign
Transcript: ENSMUST00000169123
AA Change: F23I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000133035
Gene: ENSMUSG00000091013
AA Change: F23I

DomainStartEndE-ValueType
Pfam:V1R 38 301 8e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227586
AA Change: F23I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000227629
AA Change: F23I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (60/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp1 A T 12: 85,279,008 H72Q unknown Het
Afmid T A 11: 117,835,705 D218E probably benign Het
Ankhd1 T C 18: 36,559,989 V1A Het
Atf7ip T C 6: 136,596,515 probably null Het
BC024139 C T 15: 76,124,399 V326I probably benign Het
Bfsp1 T A 2: 143,848,965 Q159L probably damaging Het
Cct2 A T 10: 117,061,465 W125R unknown Het
Cnksr3 G T 10: 7,152,931 T147K probably benign Het
Colq C G 14: 31,552,909 G101R probably damaging Het
Dlg5 G T 14: 24,177,797 T352K possibly damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Ebna1bp2 T C 4: 118,622,102 V119A probably benign Het
Eif2ak4 C T 2: 118,420,810 Q318* probably null Het
Eif2b1 G A 5: 124,571,251 T286M probably damaging Het
Fam53b G T 7: 132,759,623 D225E probably damaging Het
Fh1 A G 1: 175,607,855 I354T probably benign Het
Fnbp1 T C 2: 31,058,914 H206R probably benign Het
Gabrg3 A T 7: 57,323,696 D74E probably damaging Het
Galnt18 A T 7: 111,556,388 V246E possibly damaging Het
Glt6d1 T C 2: 25,795,280 R44G probably benign Het
Gm17087 T C 17: 8,566,803 M23V probably benign Het
Gpr160 A T 3: 30,896,777 I333L possibly damaging Het
Hars T C 18: 36,772,355 N142S possibly damaging Het
Hmgcll1 T C 9: 76,056,552 V97A possibly damaging Het
Itih4 T G 14: 30,892,603 V474G probably damaging Het
Keap1 C T 9: 21,231,256 V568I probably benign Het
Kifc5b A G 17: 26,925,898 M633V probably benign Het
Lsm4 A G 8: 70,677,785 E18G probably damaging Het
Meox1 T A 11: 101,893,743 Q88L probably damaging Het
Mettl25 T C 10: 105,829,924 N147S possibly damaging Het
Mphosph9 A C 5: 124,320,859 W83G probably damaging Het
Olfr1006 T A 2: 85,674,824 Y109F Het
Olfr1098 T G 2: 86,922,646 K295N possibly damaging Het
Olfr344 T C 2: 36,569,180 I194T probably benign Het
Olfr862 T A 9: 19,884,063 M81L probably benign Het
Olfr878 T C 9: 37,919,074 V139A probably benign Het
Olfr992 T C 2: 85,400,200 D111G probably damaging Het
Otogl G T 10: 107,778,929 T1954K probably benign Het
Padi2 T C 4: 140,933,217 V336A probably damaging Het
Phf21a C T 2: 92,360,379 Q675* probably null Het
Ppip5k1 T C 2: 121,321,750 E1092G probably damaging Het
Psg21 T C 7: 18,654,861 N102S probably damaging Het
Ralgapa1 C A 12: 55,820,723 Q15H possibly damaging Het
Rbm26 A T 14: 105,160,607 D26E unknown Het
Rbp4 T C 19: 38,124,061 Y152C probably damaging Het
Recql4 A G 15: 76,706,424 V646A possibly damaging Het
Rnf220 A T 4: 117,285,882 M63K probably benign Het
Selenok T C 14: 29,970,067 S21P probably damaging Het
Senp1 A G 15: 98,058,326 V404A probably benign Het
Sh3yl1 A G 12: 30,940,166 probably null Het
Snx32 A G 19: 5,496,990 L275P probably damaging Het
Ssfa2 T A 2: 79,635,660 S41T probably damaging Het
Stat5a T C 11: 100,879,693 V519A possibly damaging Het
Tbc1d10b A T 7: 127,203,238 V388E possibly damaging Het
Tdrd6 A G 17: 43,625,174 V1661A probably benign Het
Tmem63a T A 1: 180,961,149 F350L probably damaging Het
Trio A T 15: 27,898,000 I401K unknown Het
Ttn T C 2: 76,716,829 E32291G probably damaging Het
Tubgcp5 G T 7: 55,829,407 V1002L probably benign Het
Vav3 C T 3: 109,525,924 T410I possibly damaging Het
Vmn2r84 T A 10: 130,391,072 Q299L probably damaging Het
Vmn2r85 T A 10: 130,422,688 E499D probably benign Het
Other mutations in Vmn1r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0535:Vmn1r1 UTSW 1 182157951 missense probably benign 0.00
R1330:Vmn1r1 UTSW 1 182158007 missense probably damaging 1.00
R1696:Vmn1r1 UTSW 1 182158059 missense probably benign 0.26
R1809:Vmn1r1 UTSW 1 182157806 missense possibly damaging 0.82
R4661:Vmn1r1 UTSW 1 182157224 missense possibly damaging 0.90
R4717:Vmn1r1 UTSW 1 182157209 missense possibly damaging 0.66
R4765:Vmn1r1 UTSW 1 182157906 missense probably benign 0.00
R4772:Vmn1r1 UTSW 1 182157546 missense probably benign 0.41
R4864:Vmn1r1 UTSW 1 182157767 missense probably benign
R5369:Vmn1r1 UTSW 1 182157776 missense possibly damaging 0.87
R5594:Vmn1r1 UTSW 1 182157407 missense probably damaging 1.00
R6240:Vmn1r1 UTSW 1 182157621 missense probably damaging 1.00
R6667:Vmn1r1 UTSW 1 182157777 missense probably benign 0.22
R7686:Vmn1r1 UTSW 1 182158025 missense probably damaging 1.00
R7908:Vmn1r1 UTSW 1 182157350 missense probably benign 0.45
R7989:Vmn1r1 UTSW 1 182157350 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- CCCTCATCAGCCTGTACAAG -3'
(R):5'- TTATCCATTCCGAGACAGCC -3'

Sequencing Primer
(F):5'- CACTGATTTACATGTGAAGTCATCCC -3'
(R):5'- CATTCCGAGACAGCCATAGTGTG -3'
Posted On2019-05-15