Incidental Mutation 'R0613:Adcy9'
ID54914
Institutional Source Beutler Lab
Gene Symbol Adcy9
Ensembl Gene ENSMUSG00000005580
Gene Nameadenylate cyclase 9
SynonymsD16Wsu65e, ACtp10
MMRRC Submission 038802-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.644) question?
Stock #R0613 (G1)
Quality Score210
Status Validated
Chromosome16
Chromosomal Location4287529-4420498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4419539 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 3 (S3P)
Ref Sequence ENSEMBL: ENSMUSP00000113498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005719] [ENSMUST00000117801] [ENSMUST00000120080]
Predicted Effect probably damaging
Transcript: ENSMUST00000005719
AA Change: S3P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000005719
Gene: ENSMUSG00000005580
AA Change: S3P

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 49 75 N/A INTRINSIC
transmembrane domain 118 137 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 177 196 N/A INTRINSIC
transmembrane domain 216 235 N/A INTRINSIC
transmembrane domain 242 261 N/A INTRINSIC
transmembrane domain 281 300 N/A INTRINSIC
CYCc 325 547 1.69e-63 SMART
transmembrane domain 791 813 N/A INTRINSIC
transmembrane domain 823 845 N/A INTRINSIC
transmembrane domain 858 880 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
transmembrane domain 977 996 N/A INTRINSIC
CYCc 1023 1227 1.26e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117801
AA Change: S3P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113498
Gene: ENSMUSG00000005580
AA Change: S3P

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 49 75 N/A INTRINSIC
transmembrane domain 118 137 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 177 196 N/A INTRINSIC
transmembrane domain 216 235 N/A INTRINSIC
transmembrane domain 242 261 N/A INTRINSIC
transmembrane domain 281 300 N/A INTRINSIC
CYCc 325 547 1.69e-63 SMART
transmembrane domain 791 813 N/A INTRINSIC
transmembrane domain 823 845 N/A INTRINSIC
transmembrane domain 858 880 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
transmembrane domain 977 996 N/A INTRINSIC
CYCc 1023 1227 1.26e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120080
SMART Domains Protein: ENSMUSP00000113421
Gene: ENSMUSG00000005580

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 44 63 N/A INTRINSIC
CYCc 88 310 1.69e-63 SMART
transmembrane domain 554 576 N/A INTRINSIC
transmembrane domain 586 608 N/A INTRINSIC
transmembrane domain 621 643 N/A INTRINSIC
transmembrane domain 653 675 N/A INTRINSIC
transmembrane domain 740 759 N/A INTRINSIC
CYCc 786 990 1.26e-39 SMART
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. It is regulated by a family of G protein-coupled receptors, protein kinases, and calcium. The type 9 adenylyl cyclase is a widely distributed adenylyl cyclase, and it is stimulated by beta-adrenergic receptor activation but is insensitive to forskolin, calcium, and somatostatin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene show an increased IgG1 response to ovalbumin challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acd A T 8: 105,700,568 probably null Het
Adgrl4 T C 3: 151,543,222 probably benign Het
Aff3 T C 1: 38,209,923 E700G probably benign Het
Ahctf1 A G 1: 179,769,414 S56P probably damaging Het
Atp12a T A 14: 56,374,521 I384N probably damaging Het
Brca1 A T 11: 101,508,210 S1519T probably benign Het
Ccl25 T C 8: 4,349,850 V94A probably benign Het
Cep170 T C 1: 176,774,680 T287A probably benign Het
Ces1a A G 8: 93,025,581 S383P probably benign Het
Cntnap3 A T 13: 64,758,414 F793I probably damaging Het
Ctsm T C 13: 61,539,682 R89G probably damaging Het
Cyp2j12 T G 4: 96,102,079 T417P probably damaging Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Edn2 T A 4: 120,161,864 probably null Het
Emc1 T A 4: 139,375,072 probably benign Het
Fam189a2 T A 19: 23,986,489 N239Y probably damaging Het
Fras1 T C 5: 96,700,488 probably benign Het
Fsip2 A T 2: 82,993,795 D6624V probably damaging Het
Gpr107 A G 2: 31,178,285 Y253C probably damaging Het
Gpr108 A G 17: 57,238,174 probably benign Het
Grik1 A G 16: 88,051,333 probably null Het
Gtf3c1 G A 7: 125,644,134 P1766L possibly damaging Het
Gucy2c A T 6: 136,760,723 N293K probably damaging Het
Hps6 C A 19: 46,003,821 P66T probably benign Het
Hspa9 A T 18: 34,947,980 V216E probably damaging Het
Igsf8 T A 1: 172,317,589 M224K probably benign Het
Igsf9b T C 9: 27,326,920 V569A probably damaging Het
Itgb4 A T 11: 115,993,342 I952F probably damaging Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Khdrbs2 A G 1: 32,657,522 H344R possibly damaging Het
Kmo C A 1: 175,637,892 R71S probably damaging Het
Lrrc31 A G 3: 30,685,035 probably benign Het
Map1b T A 13: 99,441,641 D168V probably damaging Het
Mfsd6 T C 1: 52,658,696 probably benign Het
Mgst1 G A 6: 138,156,245 G186D probably damaging Het
Mrc1 C T 2: 14,294,819 A740V probably damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mtor T C 4: 148,526,046 Y1605H possibly damaging Het
Ncoa4 T A 14: 32,176,552 L443Q probably damaging Het
Nelfa G A 5: 33,903,463 probably benign Het
Nepn T A 10: 52,401,257 L363Q probably damaging Het
Nfat5 A G 8: 107,366,295 T630A possibly damaging Het
Nipal4 A T 11: 46,150,384 V328E probably benign Het
Olfr1228 A T 2: 89,249,125 C178S probably damaging Het
Olfr1391 T A 11: 49,327,748 S112R possibly damaging Het
Olfr462 A T 11: 87,889,227 V223E possibly damaging Het
Olfr747 T A 14: 50,681,404 I77F probably benign Het
Olfr809 T A 10: 129,776,262 M116K probably damaging Het
Olfr924 T A 9: 38,848,613 C166* probably null Het
Otogl A T 10: 107,817,070 N1140K probably damaging Het
Ppip5k2 A C 1: 97,752,740 Y236* probably null Het
Prelid1 C T 13: 55,324,343 R111* probably null Het
Prpf8 T C 11: 75,503,444 L1771P probably damaging Het
Ptprb A T 10: 116,302,325 Y378F possibly damaging Het
Ptprb A G 10: 116,302,378 T396A possibly damaging Het
Rab3il1 T C 19: 10,028,364 L174P probably damaging Het
Rab4a T C 8: 123,823,835 V18A possibly damaging Het
Scn3a T A 2: 65,472,284 M1273L possibly damaging Het
Sdhc A T 1: 171,129,844 V156E probably benign Het
Slco3a1 T C 7: 74,346,634 probably benign Het
Syne3 T C 12: 104,958,112 T343A probably benign Het
Syt11 A G 3: 88,762,469 C39R probably damaging Het
Tll2 G T 19: 41,104,990 D462E probably damaging Het
Tmem132e T A 11: 82,438,338 V481D probably damaging Het
Tmem161b C T 13: 84,251,320 L17F probably damaging Het
Vmn2r105 T A 17: 20,208,316 I833F probably damaging Het
Vstm2a A T 11: 16,263,140 N175I probably damaging Het
Xpnpep1 G T 19: 53,006,353 D238E probably damaging Het
Zfp112 G A 7: 24,127,028 G807D probably benign Het
Zfp518b A T 5: 38,673,603 V353E probably damaging Het
Zfp69 T C 4: 120,934,347 E39G probably benign Het
Zfp865 A G 7: 5,029,091 H25R possibly damaging Het
Other mutations in Adcy9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Adcy9 APN 16 4304582 missense probably benign
IGL00326:Adcy9 APN 16 4294696 missense probably benign
IGL00792:Adcy9 APN 16 4288539 missense probably damaging 1.00
IGL01610:Adcy9 APN 16 4418114 missense probably damaging 1.00
IGL02376:Adcy9 APN 16 4418680 missense probably benign 0.01
IGL02424:Adcy9 APN 16 4288597 missense probably damaging 1.00
IGL03097:Adcy9 UTSW 16 4418066 missense possibly damaging 0.94
PIT4243001:Adcy9 UTSW 16 4418407 missense probably damaging 1.00
R0043:Adcy9 UTSW 16 4289015 missense probably benign 0.12
R0085:Adcy9 UTSW 16 4288224 missense probably benign
R0105:Adcy9 UTSW 16 4288388 missense probably damaging 1.00
R0105:Adcy9 UTSW 16 4288388 missense probably damaging 1.00
R0371:Adcy9 UTSW 16 4288047 missense probably benign 0.06
R0689:Adcy9 UTSW 16 4312804 splice site probably benign
R0744:Adcy9 UTSW 16 4419271 missense possibly damaging 0.69
R0836:Adcy9 UTSW 16 4419271 missense possibly damaging 0.69
R1223:Adcy9 UTSW 16 4298748 missense probably damaging 1.00
R1251:Adcy9 UTSW 16 4311531 missense probably damaging 0.99
R1689:Adcy9 UTSW 16 4297562 splice site probably null
R1922:Adcy9 UTSW 16 4311657 missense probably damaging 1.00
R1955:Adcy9 UTSW 16 4418659 missense possibly damaging 0.63
R1989:Adcy9 UTSW 16 4298727 missense probably damaging 1.00
R1998:Adcy9 UTSW 16 4297412 missense probably benign 0.00
R2321:Adcy9 UTSW 16 4288268 missense probably damaging 1.00
R3160:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R3161:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R3162:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R3162:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R4065:Adcy9 UTSW 16 4288434 missense probably damaging 1.00
R4909:Adcy9 UTSW 16 4298754 missense probably benign 0.03
R5078:Adcy9 UTSW 16 4323907 missense probably benign 0.00
R5870:Adcy9 UTSW 16 4418368 missense probably damaging 1.00
R5968:Adcy9 UTSW 16 4298742 missense probably damaging 1.00
R5975:Adcy9 UTSW 16 4311567 missense probably damaging 0.98
R6014:Adcy9 UTSW 16 4418819 missense probably damaging 1.00
R6035:Adcy9 UTSW 16 4304513 missense probably benign
R6035:Adcy9 UTSW 16 4304513 missense probably benign
R6081:Adcy9 UTSW 16 4294681 missense probably benign
R6192:Adcy9 UTSW 16 4287954 missense probably benign
R6604:Adcy9 UTSW 16 4304407 missense probably damaging 0.98
R6739:Adcy9 UTSW 16 4418794 missense probably benign
R6829:Adcy9 UTSW 16 4307154 critical splice donor site probably null
R6986:Adcy9 UTSW 16 4311577 missense probably damaging 0.99
R7491:Adcy9 UTSW 16 4418809 missense possibly damaging 0.51
R7561:Adcy9 UTSW 16 4418164 missense probably damaging 1.00
R7614:Adcy9 UTSW 16 4418224 missense probably damaging 1.00
R7803:Adcy9 UTSW 16 4304380 missense probably benign 0.11
R7993:Adcy9 UTSW 16 4418002 missense probably damaging 1.00
R8444:Adcy9 UTSW 16 4288623 missense probably damaging 1.00
R8519:Adcy9 UTSW 16 4288128 missense possibly damaging 0.57
R8546:Adcy9 UTSW 16 4418905 missense probably benign 0.02
R8751:Adcy9 UTSW 16 4311628 missense probably damaging 0.97
X0023:Adcy9 UTSW 16 4323916 missense probably benign 0.00
Z1176:Adcy9 UTSW 16 4307232 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGACAGCGAAATAGATGCTCCAG -3'
(R):5'- AACATATGGTGGTGCCTTCCCAAG -3'

Sequencing Primer
(F):5'- TGGAGGCCCTCTCAAAAAG -3'
(R):5'- GCCTTCCCAAGTGGCTC -3'
Posted On2013-07-11