Incidental Mutation 'R7075:Olfr1006'
ID549143
Institutional Source Beutler Lab
Gene Symbol Olfr1006
Ensembl Gene ENSMUSG00000075211
Gene Nameolfactory receptor 1006
SynonymsMOR213-4, GA_x6K02T2Q125-47154544-47153606
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7075 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85673657-85678767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85674824 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 109 (Y109F)
Ref Sequence ENSEMBL: ENSMUSP00000097501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099917] [ENSMUST00000216084]
Predicted Effect
SMART Domains Protein: ENSMUSP00000097501
Gene: ENSMUSG00000075211
AA Change: Y109F

DomainStartEndE-ValueType
Pfam:7tm_4 39 315 1.3e-51 PFAM
Pfam:7tm_1 49 298 3.6e-20 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (60/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp1 A T 12: 85,279,008 H72Q unknown Het
Afmid T A 11: 117,835,705 D218E probably benign Het
Ankhd1 T C 18: 36,559,989 V1A Het
Atf7ip T C 6: 136,596,515 probably null Het
BC024139 C T 15: 76,124,399 V326I probably benign Het
Bfsp1 T A 2: 143,848,965 Q159L probably damaging Het
Cct2 A T 10: 117,061,465 W125R unknown Het
Cnksr3 G T 10: 7,152,931 T147K probably benign Het
Colq C G 14: 31,552,909 G101R probably damaging Het
Dlg5 G T 14: 24,177,797 T352K possibly damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Ebna1bp2 T C 4: 118,622,102 V119A probably benign Het
Eif2ak4 C T 2: 118,420,810 Q318* probably null Het
Eif2b1 G A 5: 124,571,251 T286M probably damaging Het
Fam53b G T 7: 132,759,623 D225E probably damaging Het
Fh1 A G 1: 175,607,855 I354T probably benign Het
Fnbp1 T C 2: 31,058,914 H206R probably benign Het
Gabrg3 A T 7: 57,323,696 D74E probably damaging Het
Galnt18 A T 7: 111,556,388 V246E possibly damaging Het
Glt6d1 T C 2: 25,795,280 R44G probably benign Het
Gm17087 T C 17: 8,566,803 M23V probably benign Het
Gpr160 A T 3: 30,896,777 I333L possibly damaging Het
Hars T C 18: 36,772,355 N142S possibly damaging Het
Hmgcll1 T C 9: 76,056,552 V97A possibly damaging Het
Itih4 T G 14: 30,892,603 V474G probably damaging Het
Keap1 C T 9: 21,231,256 V568I probably benign Het
Kifc5b A G 17: 26,925,898 M633V probably benign Het
Lsm4 A G 8: 70,677,785 E18G probably damaging Het
Meox1 T A 11: 101,893,743 Q88L probably damaging Het
Mettl25 T C 10: 105,829,924 N147S possibly damaging Het
Mphosph9 A C 5: 124,320,859 W83G probably damaging Het
Olfr1098 T G 2: 86,922,646 K295N possibly damaging Het
Olfr344 T C 2: 36,569,180 I194T probably benign Het
Olfr862 T A 9: 19,884,063 M81L probably benign Het
Olfr878 T C 9: 37,919,074 V139A probably benign Het
Olfr992 T C 2: 85,400,200 D111G probably damaging Het
Otogl G T 10: 107,778,929 T1954K probably benign Het
Padi2 T C 4: 140,933,217 V336A probably damaging Het
Phf21a C T 2: 92,360,379 Q675* probably null Het
Ppip5k1 T C 2: 121,321,750 E1092G probably damaging Het
Psg21 T C 7: 18,654,861 N102S probably damaging Het
Ralgapa1 C A 12: 55,820,723 Q15H possibly damaging Het
Rbm26 A T 14: 105,160,607 D26E unknown Het
Rbp4 T C 19: 38,124,061 Y152C probably damaging Het
Recql4 A G 15: 76,706,424 V646A possibly damaging Het
Rnf220 A T 4: 117,285,882 M63K probably benign Het
Selenok T C 14: 29,970,067 S21P probably damaging Het
Senp1 A G 15: 98,058,326 V404A probably benign Het
Sh3yl1 A G 12: 30,940,166 probably null Het
Snx32 A G 19: 5,496,990 L275P probably damaging Het
Ssfa2 T A 2: 79,635,660 S41T probably damaging Het
Stat5a T C 11: 100,879,693 V519A possibly damaging Het
Tbc1d10b A T 7: 127,203,238 V388E possibly damaging Het
Tdrd6 A G 17: 43,625,174 V1661A probably benign Het
Tmem63a T A 1: 180,961,149 F350L probably damaging Het
Trio A T 15: 27,898,000 I401K unknown Het
Ttn T C 2: 76,716,829 E32291G probably damaging Het
Tubgcp5 G T 7: 55,829,407 V1002L probably benign Het
Vav3 C T 3: 109,525,924 T410I possibly damaging Het
Vmn1r1 A T 1: 182,158,032 F23I probably benign Het
Vmn2r84 T A 10: 130,391,072 Q299L probably damaging Het
Vmn2r85 T A 10: 130,422,688 E499D probably benign Het
Other mutations in Olfr1006
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Olfr1006 APN 2 85674497 missense probably damaging 1.00
IGL01520:Olfr1006 APN 2 85674357 missense probably benign 0.00
IGL01939:Olfr1006 APN 2 85674941 missense probably damaging 1.00
IGL02060:Olfr1006 APN 2 85674834 missense probably benign 0.34
IGL02171:Olfr1006 APN 2 85674941 missense probably damaging 1.00
IGL03058:Olfr1006 APN 2 85674681 missense probably benign 0.00
IGL03210:Olfr1006 APN 2 85674353 missense probably damaging 1.00
R0294:Olfr1006 UTSW 2 85674716 missense probably damaging 0.99
R1304:Olfr1006 UTSW 2 85674338 missense probably damaging 1.00
R1476:Olfr1006 UTSW 2 85674918 missense possibly damaging 0.92
R4757:Olfr1006 UTSW 2 85674320 missense probably damaging 1.00
R4793:Olfr1006 UTSW 2 85674498 missense probably damaging 1.00
R5804:Olfr1006 UTSW 2 85674338 missense probably damaging 1.00
R6146:Olfr1006 UTSW 2 85674594 nonsense probably null
R6511:Olfr1006 UTSW 2 85674840 missense possibly damaging 0.61
R6896:Olfr1006 UTSW 2 85674933 missense probably damaging 0.97
R7344:Olfr1006 UTSW 2 85674931 nonsense probably null
R7350:Olfr1006 UTSW 2 85674845 missense
Predicted Primers PCR Primer
(F):5'- TTACCACAGAAAGTTAGCCGGAAG -3'
(R):5'- CATTGTCAGGGAACATGTTGC -3'

Sequencing Primer
(F):5'- AAGGTGTTTGCAGTATGGGC -3'
(R):5'- ATCCGAATTGATTCTAGACTGCATAC -3'
Posted On2019-05-15