Incidental Mutation 'R7075:Ppip5k1'
ID549147
Institutional Source Beutler Lab
Gene Symbol Ppip5k1
Ensembl Gene ENSMUSG00000033526
Gene Namediphosphoinositol pentakisphosphate kinase 1
SynonymsHisppd2a, B430315C20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R7075 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location121310561-121355396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121321750 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1092 (E1092G)
Ref Sequence ENSEMBL: ENSMUSP00000057632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052029] [ENSMUST00000110625] [ENSMUST00000110626] [ENSMUST00000110627] [ENSMUST00000110628]
Predicted Effect probably damaging
Transcript: ENSMUST00000052029
AA Change: E1092G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000057632
Gene: ENSMUSG00000033526
AA Change: E1092G

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.8e-110 PFAM
low complexity region 1163 1181 N/A INTRINSIC
coiled coil region 1402 1430 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110625
AA Change: E1071G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106255
Gene: ENSMUSG00000033526
AA Change: E1071G

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110626
AA Change: E1092G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106256
Gene: ENSMUSG00000033526
AA Change: E1092G

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 1.1e-135 PFAM
low complexity region 1163 1181 N/A INTRINSIC
coiled coil region 1402 1430 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110627
AA Change: E1071G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106257
Gene: ENSMUSG00000033526
AA Change: E1071G

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110628
AA Change: E1072G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106258
Gene: ENSMUSG00000033526
AA Change: E1072G

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 886 3.9e-101 PFAM
low complexity region 1143 1161 N/A INTRINSIC
coiled coil region 1382 1410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127255
SMART Domains Protein: ENSMUSP00000118597
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
Pfam:His_Phos_2 1 54 6.7e-9 PFAM
low complexity region 142 162 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000117948
Gene: ENSMUSG00000033526
AA Change: E239G

DomainStartEndE-ValueType
Pfam:His_Phos_2 1 117 1.4e-30 PFAM
Predicted Effect
Meta Mutation Damage Score 0.5526 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (60/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual functional inositol kinase. The encoded enzyme converts inositol hexakisphosphate to diphosphoinositol pentakisphosphate and diphosphoinositol pentakisphosphate to bis-diphosphoinositol tetrakisphosphate. This protein may be important for intracellular signaling pathways. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 15.[provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp1 A T 12: 85,279,008 H72Q unknown Het
Afmid T A 11: 117,835,705 D218E probably benign Het
Ankhd1 T C 18: 36,559,989 V1A Het
Atf7ip T C 6: 136,596,515 probably null Het
BC024139 C T 15: 76,124,399 V326I probably benign Het
Bfsp1 T A 2: 143,848,965 Q159L probably damaging Het
Cct2 A T 10: 117,061,465 W125R unknown Het
Cnksr3 G T 10: 7,152,931 T147K probably benign Het
Colq C G 14: 31,552,909 G101R probably damaging Het
Dlg5 G T 14: 24,177,797 T352K possibly damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Ebna1bp2 T C 4: 118,622,102 V119A probably benign Het
Eif2ak4 C T 2: 118,420,810 Q318* probably null Het
Eif2b1 G A 5: 124,571,251 T286M probably damaging Het
Fam53b G T 7: 132,759,623 D225E probably damaging Het
Fh1 A G 1: 175,607,855 I354T probably benign Het
Fnbp1 T C 2: 31,058,914 H206R probably benign Het
Gabrg3 A T 7: 57,323,696 D74E probably damaging Het
Galnt18 A T 7: 111,556,388 V246E possibly damaging Het
Glt6d1 T C 2: 25,795,280 R44G probably benign Het
Gm17087 T C 17: 8,566,803 M23V probably benign Het
Gpr160 A T 3: 30,896,777 I333L possibly damaging Het
Hars T C 18: 36,772,355 N142S possibly damaging Het
Hmgcll1 T C 9: 76,056,552 V97A possibly damaging Het
Itih4 T G 14: 30,892,603 V474G probably damaging Het
Keap1 C T 9: 21,231,256 V568I probably benign Het
Kifc5b A G 17: 26,925,898 M633V probably benign Het
Lsm4 A G 8: 70,677,785 E18G probably damaging Het
Meox1 T A 11: 101,893,743 Q88L probably damaging Het
Mettl25 T C 10: 105,829,924 N147S possibly damaging Het
Mphosph9 A C 5: 124,320,859 W83G probably damaging Het
Olfr1006 T A 2: 85,674,824 Y109F Het
Olfr1098 T G 2: 86,922,646 K295N possibly damaging Het
Olfr344 T C 2: 36,569,180 I194T probably benign Het
Olfr862 T A 9: 19,884,063 M81L probably benign Het
Olfr878 T C 9: 37,919,074 V139A probably benign Het
Olfr992 T C 2: 85,400,200 D111G probably damaging Het
Otogl G T 10: 107,778,929 T1954K probably benign Het
Padi2 T C 4: 140,933,217 V336A probably damaging Het
Phf21a C T 2: 92,360,379 Q675* probably null Het
Psg21 T C 7: 18,654,861 N102S probably damaging Het
Ralgapa1 C A 12: 55,820,723 Q15H possibly damaging Het
Rbm26 A T 14: 105,160,607 D26E unknown Het
Rbp4 T C 19: 38,124,061 Y152C probably damaging Het
Recql4 A G 15: 76,706,424 V646A possibly damaging Het
Rnf220 A T 4: 117,285,882 M63K probably benign Het
Selenok T C 14: 29,970,067 S21P probably damaging Het
Senp1 A G 15: 98,058,326 V404A probably benign Het
Sh3yl1 A G 12: 30,940,166 probably null Het
Snx32 A G 19: 5,496,990 L275P probably damaging Het
Ssfa2 T A 2: 79,635,660 S41T probably damaging Het
Stat5a T C 11: 100,879,693 V519A possibly damaging Het
Tbc1d10b A T 7: 127,203,238 V388E possibly damaging Het
Tdrd6 A G 17: 43,625,174 V1661A probably benign Het
Tmem63a T A 1: 180,961,149 F350L probably damaging Het
Trio A T 15: 27,898,000 I401K unknown Het
Ttn T C 2: 76,716,829 E32291G probably damaging Het
Tubgcp5 G T 7: 55,829,407 V1002L probably benign Het
Vav3 C T 3: 109,525,924 T410I possibly damaging Het
Vmn1r1 A T 1: 182,158,032 F23I probably benign Het
Vmn2r84 T A 10: 130,391,072 Q299L probably damaging Het
Vmn2r85 T A 10: 130,422,688 E499D probably benign Het
Other mutations in Ppip5k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Ppip5k1 APN 2 121347358 missense probably damaging 1.00
IGL01154:Ppip5k1 APN 2 121343179 missense probably damaging 1.00
IGL01341:Ppip5k1 APN 2 121343210 nonsense probably null
IGL01704:Ppip5k1 APN 2 121312074 missense possibly damaging 0.74
IGL01949:Ppip5k1 APN 2 121337860 missense probably benign
IGL02101:Ppip5k1 APN 2 121331608 missense possibly damaging 0.84
IGL02499:Ppip5k1 APN 2 121331553 splice site probably null
IGL02701:Ppip5k1 APN 2 121316649 splice site probably null
IGL03188:Ppip5k1 APN 2 121326846 unclassified probably benign
R0363:Ppip5k1 UTSW 2 121347355 missense probably damaging 1.00
R1315:Ppip5k1 UTSW 2 121312005 missense probably benign 0.13
R1664:Ppip5k1 UTSW 2 121337182 missense probably benign 0.02
R1753:Ppip5k1 UTSW 2 121342631 missense probably damaging 1.00
R1759:Ppip5k1 UTSW 2 121350586 missense probably benign 0.32
R1763:Ppip5k1 UTSW 2 121348547 missense probably damaging 1.00
R2033:Ppip5k1 UTSW 2 121337627 missense probably damaging 1.00
R2037:Ppip5k1 UTSW 2 121343193 missense probably damaging 1.00
R2066:Ppip5k1 UTSW 2 121342871 unclassified probably benign
R2103:Ppip5k1 UTSW 2 121321653 unclassified probably null
R3414:Ppip5k1 UTSW 2 121327661 missense probably damaging 0.97
R4022:Ppip5k1 UTSW 2 121337627 missense probably damaging 1.00
R4569:Ppip5k1 UTSW 2 121343563 missense possibly damaging 0.69
R4783:Ppip5k1 UTSW 2 121340848 missense possibly damaging 0.95
R4843:Ppip5k1 UTSW 2 121326887 missense probably damaging 1.00
R4981:Ppip5k1 UTSW 2 121312390 missense probably damaging 1.00
R5353:Ppip5k1 UTSW 2 121311720 missense probably benign 0.00
R5493:Ppip5k1 UTSW 2 121336772 missense probably damaging 1.00
R5654:Ppip5k1 UTSW 2 121316676 missense probably benign 0.00
R5835:Ppip5k1 UTSW 2 121337899 missense probably benign 0.01
R5987:Ppip5k1 UTSW 2 121350491 nonsense probably null
R6076:Ppip5k1 UTSW 2 121337110 missense probably null 1.00
R6088:Ppip5k1 UTSW 2 121337463 missense probably benign 0.29
R6276:Ppip5k1 UTSW 2 121323203 unclassified probably benign
R6555:Ppip5k1 UTSW 2 121337612 missense probably damaging 0.99
R6878:Ppip5k1 UTSW 2 121311936 missense probably benign 0.00
R7251:Ppip5k1 UTSW 2 121347571 missense probably benign 0.05
R7332:Ppip5k1 UTSW 2 121311969 missense probably damaging 0.96
R7359:Ppip5k1 UTSW 2 121340848 missense possibly damaging 0.95
R7462:Ppip5k1 UTSW 2 121336751 missense probably damaging 0.98
R7568:Ppip5k1 UTSW 2 121337615 missense probably damaging 1.00
R7654:Ppip5k1 UTSW 2 121348559 missense probably damaging 1.00
R7678:Ppip5k1 UTSW 2 121337661 missense probably damaging 1.00
R7841:Ppip5k1 UTSW 2 121342795 missense probably benign 0.13
R7877:Ppip5k1 UTSW 2 121316754 missense probably benign 0.01
R7896:Ppip5k1 UTSW 2 121347330 missense probably damaging 1.00
R7901:Ppip5k1 UTSW 2 121311909 missense probably damaging 0.99
R7911:Ppip5k1 UTSW 2 121342658 missense possibly damaging 0.89
R7924:Ppip5k1 UTSW 2 121342795 missense probably benign 0.13
R7960:Ppip5k1 UTSW 2 121316754 missense probably benign 0.01
R7979:Ppip5k1 UTSW 2 121347330 missense probably damaging 1.00
R7984:Ppip5k1 UTSW 2 121311909 missense probably damaging 0.99
R7992:Ppip5k1 UTSW 2 121342658 missense possibly damaging 0.89
X0020:Ppip5k1 UTSW 2 121341655 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGTCCTCTGTACAAGCAG -3'
(R):5'- CTGGAAATCTTGGATACCCCATC -3'

Sequencing Primer
(F):5'- AGCGCTCTTAACTGCTGAG -3'
(R):5'- TCCTCTAAAAGCCACAGATCCTCTTG -3'
Posted On2019-05-15