Incidental Mutation 'R7075:Bfsp1'
ID 549148
Institutional Source Beutler Lab
Gene Symbol Bfsp1
Ensembl Gene ENSMUSG00000027420
Gene Name beaded filament structural protein 1, in lens-CP94
Synonyms filensin
MMRRC Submission 045170-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.152) question?
Stock # R7075 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 143668448-143705093 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 143690885 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 159 (Q159L)
Ref Sequence ENSEMBL: ENSMUSP00000096899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028907] [ENSMUST00000099296]
AlphaFold A2AMT1
Predicted Effect probably damaging
Transcript: ENSMUST00000028907
AA Change: Q159L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028907
Gene: ENSMUSG00000027420
AA Change: Q159L

DomainStartEndE-ValueType
Pfam:Filament 34 205 2.5e-13 PFAM
low complexity region 400 411 N/A INTRINSIC
low complexity region 544 561 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099296
AA Change: Q159L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096899
Gene: ENSMUSG00000027420
AA Change: Q159L

DomainStartEndE-ValueType
Filament 32 317 1.05e-6 SMART
low complexity region 406 417 N/A INTRINSIC
low complexity region 550 567 N/A INTRINSIC
Meta Mutation Damage Score 0.7306 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (60/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lens-specific intermediate filament-like protein named filensin. The encoded protein is expressed in lens fiber cells after differentiation has begun. This protein functions as a component of the beaded filament which is a cytoskeletal structure found in lens fiber cells. Mutations in this gene are the cause of autosomal recessive cortical juvenile-onset cataract. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mutations in this gene produce lens abnormalities progressing to cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp1 A T 12: 85,325,782 (GRCm39) H72Q unknown Het
Afmid T A 11: 117,726,531 (GRCm39) D218E probably benign Het
Ankhd1 T C 18: 36,693,042 (GRCm39) V1A Het
Atf7ip T C 6: 136,573,513 (GRCm39) probably null Het
BC024139 C T 15: 76,008,599 (GRCm39) V326I probably benign Het
Cct2 A T 10: 116,897,370 (GRCm39) W125R unknown Het
Cnksr3 G T 10: 7,102,931 (GRCm39) T147K probably benign Het
Colq C G 14: 31,274,866 (GRCm39) G101R probably damaging Het
Dlg5 G T 14: 24,227,865 (GRCm39) T352K possibly damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 72,684,217 (GRCm39) probably benign Het
Ebna1bp2 T C 4: 118,479,299 (GRCm39) V119A probably benign Het
Eif2ak4 C T 2: 118,251,291 (GRCm39) Q318* probably null Het
Eif2b1 G A 5: 124,709,314 (GRCm39) T286M probably damaging Het
Fam53b G T 7: 132,361,352 (GRCm39) D225E probably damaging Het
Fh1 A G 1: 175,435,421 (GRCm39) I354T probably benign Het
Fnbp1 T C 2: 30,948,926 (GRCm39) H206R probably benign Het
Gabrg3 A T 7: 56,973,444 (GRCm39) D74E probably damaging Het
Galnt18 A T 7: 111,155,595 (GRCm39) V246E possibly damaging Het
Glt6d1 T C 2: 25,685,292 (GRCm39) R44G probably benign Het
Gm17087 T C 17: 8,785,635 (GRCm39) M23V probably benign Het
Gpr160 A T 3: 30,950,926 (GRCm39) I333L possibly damaging Het
Hars1 T C 18: 36,905,408 (GRCm39) N142S possibly damaging Het
Hmgcll1 T C 9: 75,963,834 (GRCm39) V97A possibly damaging Het
Itih4 T G 14: 30,614,560 (GRCm39) V474G probably damaging Het
Itprid2 T A 2: 79,466,004 (GRCm39) S41T probably damaging Het
Keap1 C T 9: 21,142,552 (GRCm39) V568I probably benign Het
Kifc5b A G 17: 27,144,872 (GRCm39) M633V probably benign Het
Lsm4 A G 8: 71,130,435 (GRCm39) E18G probably damaging Het
Meox1 T A 11: 101,784,569 (GRCm39) Q88L probably damaging Het
Mettl25 T C 10: 105,665,785 (GRCm39) N147S possibly damaging Het
Mphosph9 A C 5: 124,458,922 (GRCm39) W83G probably damaging Het
Or1j15 T C 2: 36,459,192 (GRCm39) I194T probably benign Het
Or5ak22 T C 2: 85,230,544 (GRCm39) D111G probably damaging Het
Or7e170 T A 9: 19,795,359 (GRCm39) M81L probably benign Het
Or8b4 T C 9: 37,830,370 (GRCm39) V139A probably benign Het
Or8h8 T G 2: 86,752,990 (GRCm39) K295N possibly damaging Het
Or9g4 T A 2: 85,505,168 (GRCm39) Y109F Het
Otogl G T 10: 107,614,790 (GRCm39) T1954K probably benign Het
Padi2 T C 4: 140,660,528 (GRCm39) V336A probably damaging Het
Phf21a C T 2: 92,190,724 (GRCm39) Q675* probably null Het
Ppip5k1 T C 2: 121,152,231 (GRCm39) E1092G probably damaging Het
Psg21 T C 7: 18,388,786 (GRCm39) N102S probably damaging Het
Ralgapa1 C A 12: 55,867,508 (GRCm39) Q15H possibly damaging Het
Rbm26 A T 14: 105,398,043 (GRCm39) D26E unknown Het
Rbp4 T C 19: 38,112,509 (GRCm39) Y152C probably damaging Het
Recql4 A G 15: 76,590,624 (GRCm39) V646A possibly damaging Het
Rnf220 A T 4: 117,143,079 (GRCm39) M63K probably benign Het
Selenok T C 14: 29,692,024 (GRCm39) S21P probably damaging Het
Senp1 A G 15: 97,956,207 (GRCm39) V404A probably benign Het
Sh3yl1 A G 12: 30,990,165 (GRCm39) probably null Het
Snx32 A G 19: 5,547,018 (GRCm39) L275P probably damaging Het
Stat5a T C 11: 100,770,519 (GRCm39) V519A possibly damaging Het
Tbc1d10b A T 7: 126,802,410 (GRCm39) V388E possibly damaging Het
Tdrd6 A G 17: 43,936,065 (GRCm39) V1661A probably benign Het
Tmem63a T A 1: 180,788,714 (GRCm39) F350L probably damaging Het
Trio A T 15: 27,898,086 (GRCm39) I401K unknown Het
Ttn T C 2: 76,547,173 (GRCm39) E32291G probably damaging Het
Tubgcp5 G T 7: 55,479,155 (GRCm39) V1002L probably benign Het
Vav3 C T 3: 109,433,240 (GRCm39) T410I possibly damaging Het
Vmn1r1 A T 1: 181,985,597 (GRCm39) F23I probably benign Het
Vmn2r84 T A 10: 130,226,941 (GRCm39) Q299L probably damaging Het
Vmn2r85 T A 10: 130,258,557 (GRCm39) E499D probably benign Het
Other mutations in Bfsp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Bfsp1 APN 2 143,673,812 (GRCm39) missense probably damaging 1.00
IGL01457:Bfsp1 APN 2 143,669,564 (GRCm39) splice site probably benign
IGL02329:Bfsp1 APN 2 143,704,566 (GRCm39) missense probably benign
IGL02354:Bfsp1 APN 2 143,673,907 (GRCm39) missense probably damaging 1.00
IGL02361:Bfsp1 APN 2 143,673,907 (GRCm39) missense probably damaging 1.00
IGL02365:Bfsp1 APN 2 143,668,656 (GRCm39) missense probably damaging 1.00
IGL02407:Bfsp1 APN 2 143,668,853 (GRCm39) missense probably benign 0.00
IGL03118:Bfsp1 APN 2 143,669,253 (GRCm39) missense possibly damaging 0.94
I0000:Bfsp1 UTSW 2 143,687,888 (GRCm39) missense probably damaging 1.00
R0112:Bfsp1 UTSW 2 143,669,563 (GRCm39) splice site probably null
R0657:Bfsp1 UTSW 2 143,669,570 (GRCm39) splice site probably benign
R1642:Bfsp1 UTSW 2 143,683,683 (GRCm39) missense probably damaging 1.00
R1816:Bfsp1 UTSW 2 143,683,599 (GRCm39) missense probably benign 0.23
R2061:Bfsp1 UTSW 2 143,704,598 (GRCm39) missense probably benign 0.08
R2248:Bfsp1 UTSW 2 143,669,572 (GRCm39) splice site probably null
R3024:Bfsp1 UTSW 2 143,687,879 (GRCm39) missense probably benign 0.19
R4029:Bfsp1 UTSW 2 143,673,749 (GRCm39) splice site probably benign
R4914:Bfsp1 UTSW 2 143,669,391 (GRCm39) missense probably benign 0.21
R4915:Bfsp1 UTSW 2 143,669,391 (GRCm39) missense probably benign 0.21
R4917:Bfsp1 UTSW 2 143,669,391 (GRCm39) missense probably benign 0.21
R4918:Bfsp1 UTSW 2 143,669,391 (GRCm39) missense probably benign 0.21
R5018:Bfsp1 UTSW 2 143,704,802 (GRCm39) missense possibly damaging 0.81
R5202:Bfsp1 UTSW 2 143,668,891 (GRCm39) missense probably benign
R5267:Bfsp1 UTSW 2 143,668,971 (GRCm39) missense probably benign 0.03
R5304:Bfsp1 UTSW 2 143,669,211 (GRCm39) missense probably benign 0.34
R5825:Bfsp1 UTSW 2 143,669,379 (GRCm39) missense probably benign 0.01
R6465:Bfsp1 UTSW 2 143,699,975 (GRCm39) critical splice donor site probably null
R6888:Bfsp1 UTSW 2 143,668,639 (GRCm39) missense probably benign 0.31
R7036:Bfsp1 UTSW 2 143,668,843 (GRCm39) missense possibly damaging 0.65
R7362:Bfsp1 UTSW 2 143,668,795 (GRCm39) missense probably benign 0.19
R7538:Bfsp1 UTSW 2 143,673,755 (GRCm39) critical splice donor site probably null
R7839:Bfsp1 UTSW 2 143,673,770 (GRCm39) missense possibly damaging 0.79
X0022:Bfsp1 UTSW 2 143,700,037 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATTCCCGGCATATCCTG -3'
(R):5'- TTATCAAGTCCCCACCTCGG -3'

Sequencing Primer
(F):5'- GATGTTCTCTAGGCACCTCTGG -3'
(R):5'- ACCTCGGCCCTGTGTTTCTAC -3'
Posted On 2019-05-15