Incidental Mutation 'R7075:Mphosph9'
ID549154
Institutional Source Beutler Lab
Gene Symbol Mphosph9
Ensembl Gene ENSMUSG00000038126
Gene NameM-phase phosphoprotein 9
SynonymsMPP-9, MPP9, B930097C17Rik, 9630025B04Rik, 4930548D04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7075 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location124250959-124327972 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 124320859 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 83 (W83G)
Ref Sequence ENSEMBL: ENSMUSP00000138982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031344] [ENSMUST00000130502] [ENSMUST00000141203] [ENSMUST00000147737] [ENSMUST00000184951]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031344
AA Change: W83G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031344
Gene: ENSMUSG00000038126
AA Change: W83G

DomainStartEndE-ValueType
low complexity region 102 119 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
coiled coil region 574 736 N/A INTRINSIC
low complexity region 879 898 N/A INTRINSIC
low complexity region 957 971 N/A INTRINSIC
coiled coil region 1040 1105 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130502
SMART Domains Protein: ENSMUSP00000120827
Gene: ENSMUSG00000038126

DomainStartEndE-ValueType
low complexity region 47 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141203
Predicted Effect probably benign
Transcript: ENSMUST00000147737
Predicted Effect probably damaging
Transcript: ENSMUST00000184951
AA Change: W83G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138982
Gene: ENSMUSG00000038126
AA Change: W83G

DomainStartEndE-ValueType
coiled coil region 102 130 N/A INTRINSIC
low complexity region 132 149 N/A INTRINSIC
low complexity region 158 170 N/A INTRINSIC
low complexity region 444 458 N/A INTRINSIC
coiled coil region 604 766 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
low complexity region 987 1001 N/A INTRINSIC
coiled coil region 1070 1135 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (60/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp1 A T 12: 85,279,008 H72Q unknown Het
Afmid T A 11: 117,835,705 D218E probably benign Het
Ankhd1 T C 18: 36,559,989 V1A Het
Atf7ip T C 6: 136,596,515 probably null Het
BC024139 C T 15: 76,124,399 V326I probably benign Het
Bfsp1 T A 2: 143,848,965 Q159L probably damaging Het
Cct2 A T 10: 117,061,465 W125R unknown Het
Cnksr3 G T 10: 7,152,931 T147K probably benign Het
Colq C G 14: 31,552,909 G101R probably damaging Het
Dlg5 G T 14: 24,177,797 T352K possibly damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Ebna1bp2 T C 4: 118,622,102 V119A probably benign Het
Eif2ak4 C T 2: 118,420,810 Q318* probably null Het
Eif2b1 G A 5: 124,571,251 T286M probably damaging Het
Fam53b G T 7: 132,759,623 D225E probably damaging Het
Fh1 A G 1: 175,607,855 I354T probably benign Het
Fnbp1 T C 2: 31,058,914 H206R probably benign Het
Gabrg3 A T 7: 57,323,696 D74E probably damaging Het
Galnt18 A T 7: 111,556,388 V246E possibly damaging Het
Glt6d1 T C 2: 25,795,280 R44G probably benign Het
Gm17087 T C 17: 8,566,803 M23V probably benign Het
Gpr160 A T 3: 30,896,777 I333L possibly damaging Het
Hars T C 18: 36,772,355 N142S possibly damaging Het
Hmgcll1 T C 9: 76,056,552 V97A possibly damaging Het
Itih4 T G 14: 30,892,603 V474G probably damaging Het
Keap1 C T 9: 21,231,256 V568I probably benign Het
Kifc5b A G 17: 26,925,898 M633V probably benign Het
Lsm4 A G 8: 70,677,785 E18G probably damaging Het
Meox1 T A 11: 101,893,743 Q88L probably damaging Het
Mettl25 T C 10: 105,829,924 N147S possibly damaging Het
Olfr1006 T A 2: 85,674,824 Y109F Het
Olfr1098 T G 2: 86,922,646 K295N possibly damaging Het
Olfr344 T C 2: 36,569,180 I194T probably benign Het
Olfr862 T A 9: 19,884,063 M81L probably benign Het
Olfr878 T C 9: 37,919,074 V139A probably benign Het
Olfr992 T C 2: 85,400,200 D111G probably damaging Het
Otogl G T 10: 107,778,929 T1954K probably benign Het
Padi2 T C 4: 140,933,217 V336A probably damaging Het
Phf21a C T 2: 92,360,379 Q675* probably null Het
Ppip5k1 T C 2: 121,321,750 E1092G probably damaging Het
Psg21 T C 7: 18,654,861 N102S probably damaging Het
Ralgapa1 C A 12: 55,820,723 Q15H possibly damaging Het
Rbm26 A T 14: 105,160,607 D26E unknown Het
Rbp4 T C 19: 38,124,061 Y152C probably damaging Het
Recql4 A G 15: 76,706,424 V646A possibly damaging Het
Rnf220 A T 4: 117,285,882 M63K probably benign Het
Selenok T C 14: 29,970,067 S21P probably damaging Het
Senp1 A G 15: 98,058,326 V404A probably benign Het
Sh3yl1 A G 12: 30,940,166 probably null Het
Snx32 A G 19: 5,496,990 L275P probably damaging Het
Ssfa2 T A 2: 79,635,660 S41T probably damaging Het
Stat5a T C 11: 100,879,693 V519A possibly damaging Het
Tbc1d10b A T 7: 127,203,238 V388E possibly damaging Het
Tdrd6 A G 17: 43,625,174 V1661A probably benign Het
Tmem63a T A 1: 180,961,149 F350L probably damaging Het
Trio A T 15: 27,898,000 I401K unknown Het
Ttn T C 2: 76,716,829 E32291G probably damaging Het
Tubgcp5 G T 7: 55,829,407 V1002L probably benign Het
Vav3 C T 3: 109,525,924 T410I possibly damaging Het
Vmn1r1 A T 1: 182,158,032 F23I probably benign Het
Vmn2r84 T A 10: 130,391,072 Q299L probably damaging Het
Vmn2r85 T A 10: 130,422,688 E499D probably benign Het
Other mutations in Mphosph9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Mphosph9 APN 5 124262021 missense probably damaging 1.00
IGL01527:Mphosph9 APN 5 124283624 splice site probably benign
IGL01784:Mphosph9 APN 5 124265310 splice site probably benign
IGL01958:Mphosph9 APN 5 124324990 utr 5 prime probably benign
IGL02020:Mphosph9 APN 5 124258950 missense probably damaging 0.99
IGL02190:Mphosph9 APN 5 124265425 missense possibly damaging 0.92
IGL02261:Mphosph9 APN 5 124260087 missense probably damaging 1.00
IGL02569:Mphosph9 APN 5 124297571 nonsense probably null
IGL02640:Mphosph9 APN 5 124315500 missense possibly damaging 0.66
IGL02702:Mphosph9 APN 5 124259989 missense probably damaging 1.00
IGL02793:Mphosph9 APN 5 124283737 critical splice acceptor site probably null
IGL02813:Mphosph9 APN 5 124315628 missense probably benign 0.37
IGL02875:Mphosph9 APN 5 124283737 critical splice acceptor site probably null
IGL03149:Mphosph9 APN 5 124263011 missense probably damaging 1.00
PIT4445001:Mphosph9 UTSW 5 124298790 missense possibly damaging 0.82
R0304:Mphosph9 UTSW 5 124298829 missense probably benign 0.01
R0437:Mphosph9 UTSW 5 124315568 missense probably benign 0.27
R0483:Mphosph9 UTSW 5 124306970 nonsense probably null
R0811:Mphosph9 UTSW 5 124298759 missense probably damaging 1.00
R0812:Mphosph9 UTSW 5 124298759 missense probably damaging 1.00
R0942:Mphosph9 UTSW 5 124262037 nonsense probably null
R1175:Mphosph9 UTSW 5 124315676 missense possibly damaging 0.94
R1372:Mphosph9 UTSW 5 124283745 splice site probably null
R1442:Mphosph9 UTSW 5 124265398 missense possibly damaging 0.62
R1533:Mphosph9 UTSW 5 124267141 missense probably damaging 1.00
R1959:Mphosph9 UTSW 5 124315701 missense possibly damaging 0.92
R2036:Mphosph9 UTSW 5 124304211 missense probably damaging 0.97
R2256:Mphosph9 UTSW 5 124283659 missense probably benign 0.00
R2919:Mphosph9 UTSW 5 124261006 missense probably benign 0.22
R2920:Mphosph9 UTSW 5 124261006 missense probably benign 0.22
R4064:Mphosph9 UTSW 5 124290917 missense probably damaging 1.00
R4272:Mphosph9 UTSW 5 124304203 missense probably damaging 0.96
R4430:Mphosph9 UTSW 5 124265446 missense possibly damaging 0.83
R4883:Mphosph9 UTSW 5 124299045 missense probably damaging 1.00
R4992:Mphosph9 UTSW 5 124304190 missense probably damaging 1.00
R5815:Mphosph9 UTSW 5 124315418 missense probably damaging 1.00
R5993:Mphosph9 UTSW 5 124316098 missense probably benign 0.40
R6102:Mphosph9 UTSW 5 124297709 missense possibly damaging 0.86
R6295:Mphosph9 UTSW 5 124320915 missense possibly damaging 0.46
R6320:Mphosph9 UTSW 5 124324961 missense probably damaging 0.99
R6628:Mphosph9 UTSW 5 124298762 missense probably damaging 0.98
R6692:Mphosph9 UTSW 5 124260116 missense probably damaging 1.00
R6705:Mphosph9 UTSW 5 124290964 missense possibly damaging 0.83
R6747:Mphosph9 UTSW 5 124297699 missense possibly damaging 0.93
R6787:Mphosph9 UTSW 5 124261027 missense probably damaging 0.99
R6850:Mphosph9 UTSW 5 124260956 missense probably damaging 1.00
R6956:Mphosph9 UTSW 5 124297558 missense probably damaging 1.00
R7604:Mphosph9 UTSW 5 124316117 missense probably benign 0.01
R7789:Mphosph9 UTSW 5 124315587 missense probably damaging 1.00
R7808:Mphosph9 UTSW 5 124260946 missense probably damaging 0.99
R7823:Mphosph9 UTSW 5 124304256 missense probably damaging 0.99
R7891:Mphosph9 UTSW 5 124290904 missense probably damaging 1.00
R7974:Mphosph9 UTSW 5 124290904 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATTGAGGCCACCACCTTCC -3'
(R):5'- CAACGCTTCAGTCCAATGAGG -3'

Sequencing Primer
(F):5'- TTTCTTGTTCCTTCAGTATCGGTG -3'
(R):5'- CCAATGAGGAAAACCATCTGAATTG -3'
Posted On2019-05-15