Mutagenetix > Incidental Mutations

Incidental Mutation 'R7075:Mphosph9'

549154

Institutional Source

Beutler Lab

Gene Symbol

Mphosph9

Ensembl Gene

ENSMUSG00000038126

Gene Name

M-phase phosphoprotein 9

Synonyms

MPP-9, MPP9, B930097C17Rik, 9630025B04Rik, 4930548D04Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7075 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124250959-124327972 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 124320859 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Glycine at position 83 (W83G)

Ref Sequence

ENSEMBL: ENSMUSP00000138982 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031344] [ENSMUST00000130502] [ENSMUST00000141203] [ENSMUST00000147737] [ENSMUST00000184951]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031344
AA Change: W83G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000031344
Gene: ENSMUSG00000038126
AA Change: W83G

Domain	Start	End	E-Value	Type
low complexity region	102	119	N/A	INTRINSIC
low complexity region	128	140	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
coiled coil region	574	736	N/A	INTRINSIC
low complexity region	879	898	N/A	INTRINSIC
low complexity region	957	971	N/A	INTRINSIC
coiled coil region	1040	1105	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130502

SMART Domains

Protein: ENSMUSP00000120827
Gene: ENSMUSG00000038126

Domain	Start	End	E-Value	Type
low complexity region	47	74	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141203

Predicted Effect

probably benign
Transcript: ENSMUST00000147737

Predicted Effect

probably damaging
Transcript: ENSMUST00000184951
AA Change: W83G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000138982
Gene: ENSMUSG00000038126
AA Change: W83G

Domain	Start	End	E-Value	Type
coiled coil region	102	130	N/A	INTRINSIC
low complexity region	132	149	N/A	INTRINSIC
low complexity region	158	170	N/A	INTRINSIC
low complexity region	444	458	N/A	INTRINSIC
coiled coil region	604	766	N/A	INTRINSIC
low complexity region	909	928	N/A	INTRINSIC
low complexity region	987	1001	N/A	INTRINSIC
coiled coil region	1070	1135	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

95% (60/63)

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acyp1	A	T	12: 85,279,008	H72Q	unknown	Het
Afmid	T	A	11: 117,835,705	D218E	probably benign	Het
Ankhd1	T	C	18: 36,559,989	V1A		Het
Atf7ip	T	C	6: 136,596,515		probably null	Het
BC024139	C	T	15: 76,124,399	V326I	probably benign	Het
Bfsp1	T	A	2: 143,848,965	Q159L	probably damaging	Het
Cct2	A	T	10: 117,061,465	W125R	unknown	Het
Cnksr3	G	T	10: 7,152,931	T147K	probably benign	Het
Colq	C	G	14: 31,552,909	G101R	probably damaging	Het
Dlg5	G	T	14: 24,177,797	T352K	possibly damaging	Het
Dusp9	TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG	TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG	X: 73,640,611		probably benign	Het
Ebna1bp2	T	C	4: 118,622,102	V119A	probably benign	Het
Eif2ak4	C	T	2: 118,420,810	Q318*	probably null	Het
Eif2b1	G	A	5: 124,571,251	T286M	probably damaging	Het
Fam53b	G	T	7: 132,759,623	D225E	probably damaging	Het
Fh1	A	G	1: 175,607,855	I354T	probably benign	Het
Fnbp1	T	C	2: 31,058,914	H206R	probably benign	Het
Gabrg3	A	T	7: 57,323,696	D74E	probably damaging	Het
Galnt18	A	T	7: 111,556,388	V246E	possibly damaging	Het
Glt6d1	T	C	2: 25,795,280	R44G	probably benign	Het
Gm17087	T	C	17: 8,566,803	M23V	probably benign	Het
Gpr160	A	T	3: 30,896,777	I333L	possibly damaging	Het
Hars	T	C	18: 36,772,355	N142S	possibly damaging	Het
Hmgcll1	T	C	9: 76,056,552	V97A	possibly damaging	Het
Itih4	T	G	14: 30,892,603	V474G	probably damaging	Het
Keap1	C	T	9: 21,231,256	V568I	probably benign	Het
Kifc5b	A	G	17: 26,925,898	M633V	probably benign	Het
Lsm4	A	G	8: 70,677,785	E18G	probably damaging	Het
Meox1	T	A	11: 101,893,743	Q88L	probably damaging	Het
Mettl25	T	C	10: 105,829,924	N147S	possibly damaging	Het
Olfr1006	T	A	2: 85,674,824	Y109F		Het
Olfr1098	T	G	2: 86,922,646	K295N	possibly damaging	Het
Olfr344	T	C	2: 36,569,180	I194T	probably benign	Het
Olfr862	T	A	9: 19,884,063	M81L	probably benign	Het
Olfr878	T	C	9: 37,919,074	V139A	probably benign	Het
Olfr992	T	C	2: 85,400,200	D111G	probably damaging	Het
Otogl	G	T	10: 107,778,929	T1954K	probably benign	Het
Padi2	T	C	4: 140,933,217	V336A	probably damaging	Het
Phf21a	C	T	2: 92,360,379	Q675*	probably null	Het
Ppip5k1	T	C	2: 121,321,750	E1092G	probably damaging	Het
Psg21	T	C	7: 18,654,861	N102S	probably damaging	Het
Ralgapa1	C	A	12: 55,820,723	Q15H	possibly damaging	Het
Rbm26	A	T	14: 105,160,607	D26E	unknown	Het
Rbp4	T	C	19: 38,124,061	Y152C	probably damaging	Het
Recql4	A	G	15: 76,706,424	V646A	possibly damaging	Het
Rnf220	A	T	4: 117,285,882	M63K	probably benign	Het
Selenok	T	C	14: 29,970,067	S21P	probably damaging	Het
Senp1	A	G	15: 98,058,326	V404A	probably benign	Het
Sh3yl1	A	G	12: 30,940,166		probably null	Het
Snx32	A	G	19: 5,496,990	L275P	probably damaging	Het
Ssfa2	T	A	2: 79,635,660	S41T	probably damaging	Het
Stat5a	T	C	11: 100,879,693	V519A	possibly damaging	Het
Tbc1d10b	A	T	7: 127,203,238	V388E	possibly damaging	Het
Tdrd6	A	G	17: 43,625,174	V1661A	probably benign	Het
Tmem63a	T	A	1: 180,961,149	F350L	probably damaging	Het
Trio	A	T	15: 27,898,000	I401K	unknown	Het
Ttn	T	C	2: 76,716,829	E32291G	probably damaging	Het
Tubgcp5	G	T	7: 55,829,407	V1002L	probably benign	Het
Vav3	C	T	3: 109,525,924	T410I	possibly damaging	Het
Vmn1r1	A	T	1: 182,158,032	F23I	probably benign	Het
Vmn2r84	T	A	10: 130,391,072	Q299L	probably damaging	Het
Vmn2r85	T	A	10: 130,422,688	E499D	probably benign	Het

Other mutations in Mphosph9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Mphosph9	APN	5	124262021	missense	probably damaging	1.00
IGL01527:Mphosph9	APN	5	124283624	splice site	probably benign
IGL01784:Mphosph9	APN	5	124265310	splice site	probably benign
IGL01958:Mphosph9	APN	5	124324990	utr 5 prime	probably benign
IGL02020:Mphosph9	APN	5	124258950	missense	probably damaging	0.99
IGL02190:Mphosph9	APN	5	124265425	missense	possibly damaging	0.92
IGL02261:Mphosph9	APN	5	124260087	missense	probably damaging	1.00
IGL02569:Mphosph9	APN	5	124297571	nonsense	probably null
IGL02640:Mphosph9	APN	5	124315500	missense	possibly damaging	0.66
IGL02702:Mphosph9	APN	5	124259989	missense	probably damaging	1.00
IGL02793:Mphosph9	APN	5	124283737	critical splice acceptor site	probably null
IGL02813:Mphosph9	APN	5	124315628	missense	probably benign	0.37
IGL02875:Mphosph9	APN	5	124283737	critical splice acceptor site	probably null
IGL03149:Mphosph9	APN	5	124263011	missense	probably damaging	1.00
PIT4445001:Mphosph9	UTSW	5	124298790	missense	possibly damaging	0.82
R0304:Mphosph9	UTSW	5	124298829	missense	probably benign	0.01
R0437:Mphosph9	UTSW	5	124315568	missense	probably benign	0.27
R0483:Mphosph9	UTSW	5	124306970	nonsense	probably null
R0811:Mphosph9	UTSW	5	124298759	missense	probably damaging	1.00
R0812:Mphosph9	UTSW	5	124298759	missense	probably damaging	1.00
R0942:Mphosph9	UTSW	5	124262037	nonsense	probably null
R1175:Mphosph9	UTSW	5	124315676	missense	possibly damaging	0.94
R1372:Mphosph9	UTSW	5	124283745	splice site	probably null
R1442:Mphosph9	UTSW	5	124265398	missense	possibly damaging	0.62
R1533:Mphosph9	UTSW	5	124267141	missense	probably damaging	1.00
R1959:Mphosph9	UTSW	5	124315701	missense	possibly damaging	0.92
R2036:Mphosph9	UTSW	5	124304211	missense	probably damaging	0.97
R2256:Mphosph9	UTSW	5	124283659	missense	probably benign	0.00
R2919:Mphosph9	UTSW	5	124261006	missense	probably benign	0.22
R2920:Mphosph9	UTSW	5	124261006	missense	probably benign	0.22
R4064:Mphosph9	UTSW	5	124290917	missense	probably damaging	1.00
R4272:Mphosph9	UTSW	5	124304203	missense	probably damaging	0.96
R4430:Mphosph9	UTSW	5	124265446	missense	possibly damaging	0.83
R4883:Mphosph9	UTSW	5	124299045	missense	probably damaging	1.00
R4992:Mphosph9	UTSW	5	124304190	missense	probably damaging	1.00
R5815:Mphosph9	UTSW	5	124315418	missense	probably damaging	1.00
R5993:Mphosph9	UTSW	5	124316098	missense	probably benign	0.40
R6102:Mphosph9	UTSW	5	124297709	missense	possibly damaging	0.86
R6295:Mphosph9	UTSW	5	124320915	missense	possibly damaging	0.46
R6320:Mphosph9	UTSW	5	124324961	missense	probably damaging	0.99
R6628:Mphosph9	UTSW	5	124298762	missense	probably damaging	0.98
R6692:Mphosph9	UTSW	5	124260116	missense	probably damaging	1.00
R6705:Mphosph9	UTSW	5	124290964	missense	possibly damaging	0.83
R6747:Mphosph9	UTSW	5	124297699	missense	possibly damaging	0.93
R6787:Mphosph9	UTSW	5	124261027	missense	probably damaging	0.99
R6850:Mphosph9	UTSW	5	124260956	missense	probably damaging	1.00
R6956:Mphosph9	UTSW	5	124297558	missense	probably damaging	1.00
R7604:Mphosph9	UTSW	5	124316117	missense	probably benign	0.01
R7789:Mphosph9	UTSW	5	124315587	missense	probably damaging	1.00
R7808:Mphosph9	UTSW	5	124260946	missense	probably damaging	0.99
R7823:Mphosph9	UTSW	5	124304256	missense	probably damaging	0.99
R7891:Mphosph9	UTSW	5	124290904	missense	probably damaging	1.00
R8210:Mphosph9	UTSW	5	124267111	missense	probably damaging	1.00
R8256:Mphosph9	UTSW	5	124255106	missense	probably damaging	1.00
R8385:Mphosph9	UTSW	5	124312722	missense	probably benign	0.19
R8438:Mphosph9	UTSW	5	124292392	missense	probably benign	0.19
R8692:Mphosph9	UTSW	5	124312812	missense	probably damaging	0.99
R8790:Mphosph9	UTSW	5	124315673	missense	probably damaging	1.00
R8818:Mphosph9	UTSW	5	124324964	nonsense	probably null
R8847:Mphosph9	UTSW	5	124316146	missense	possibly damaging	0.91
R9018:Mphosph9	UTSW	5	124298650	missense	probably benign	0.12
R9208:Mphosph9	UTSW	5	124312791	missense	probably damaging	0.97
R9221:Mphosph9	UTSW	5	124265364	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- TATTGAGGCCACCACCTTCC -3'
(R):5'- CAACGCTTCAGTCCAATGAGG -3'

Sequencing Primer
(F):5'- TTTCTTGTTCCTTCAGTATCGGTG -3'
(R):5'- CCAATGAGGAAAACCATCTGAATTG -3'

Posted On

2019-05-15