Incidental Mutation 'R7075:Tbc1d10b'
ID549161
Institutional Source Beutler Lab
Gene Symbol Tbc1d10b
Ensembl Gene ENSMUSG00000042492
Gene NameTBC1 domain family, member 10b
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.472) question?
Stock #R7075 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127197459-127208468 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127203238 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 388 (V388E)
Ref Sequence ENSEMBL: ENSMUSP00000113307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120705]
Predicted Effect possibly damaging
Transcript: ENSMUST00000120705
AA Change: V388E

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113307
Gene: ENSMUSG00000042492
AA Change: V388E

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
low complexity region 66 81 N/A INTRINSIC
low complexity region 129 143 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 207 227 N/A INTRINSIC
Blast:TBC 274 305 6e-10 BLAST
TBC 343 557 8.23e-57 SMART
low complexity region 632 678 N/A INTRINSIC
coiled coil region 701 769 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (60/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Small G proteins of the RAB family (see MIM 179508) function in intracellular vesicle trafficking by switching from the GTP-bound state to the GDP-bound state with the assistance of guanine nucleotide exchange factors (GEFs; see MIM 609700) and GTPase-activating proteins (GAPs). TBC1D10B functions as a GAP for several proteins of the Rab family (Ishibashi et al., 2009 [PubMed 19077034]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp1 A T 12: 85,279,008 H72Q unknown Het
Afmid T A 11: 117,835,705 D218E probably benign Het
Ankhd1 T C 18: 36,559,989 V1A Het
Atf7ip T C 6: 136,596,515 probably null Het
BC024139 C T 15: 76,124,399 V326I probably benign Het
Bfsp1 T A 2: 143,848,965 Q159L probably damaging Het
Cct2 A T 10: 117,061,465 W125R unknown Het
Cnksr3 G T 10: 7,152,931 T147K probably benign Het
Colq C G 14: 31,552,909 G101R probably damaging Het
Dlg5 G T 14: 24,177,797 T352K possibly damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Ebna1bp2 T C 4: 118,622,102 V119A probably benign Het
Eif2ak4 C T 2: 118,420,810 Q318* probably null Het
Eif2b1 G A 5: 124,571,251 T286M probably damaging Het
Fam53b G T 7: 132,759,623 D225E probably damaging Het
Fh1 A G 1: 175,607,855 I354T probably benign Het
Fnbp1 T C 2: 31,058,914 H206R probably benign Het
Gabrg3 A T 7: 57,323,696 D74E probably damaging Het
Galnt18 A T 7: 111,556,388 V246E possibly damaging Het
Glt6d1 T C 2: 25,795,280 R44G probably benign Het
Gm17087 T C 17: 8,566,803 M23V probably benign Het
Gpr160 A T 3: 30,896,777 I333L possibly damaging Het
Hars T C 18: 36,772,355 N142S possibly damaging Het
Hmgcll1 T C 9: 76,056,552 V97A possibly damaging Het
Itih4 T G 14: 30,892,603 V474G probably damaging Het
Keap1 C T 9: 21,231,256 V568I probably benign Het
Kifc5b A G 17: 26,925,898 M633V probably benign Het
Lsm4 A G 8: 70,677,785 E18G probably damaging Het
Meox1 T A 11: 101,893,743 Q88L probably damaging Het
Mettl25 T C 10: 105,829,924 N147S possibly damaging Het
Mphosph9 A C 5: 124,320,859 W83G probably damaging Het
Olfr1006 T A 2: 85,674,824 Y109F Het
Olfr1098 T G 2: 86,922,646 K295N possibly damaging Het
Olfr344 T C 2: 36,569,180 I194T probably benign Het
Olfr862 T A 9: 19,884,063 M81L probably benign Het
Olfr878 T C 9: 37,919,074 V139A probably benign Het
Olfr992 T C 2: 85,400,200 D111G probably damaging Het
Otogl G T 10: 107,778,929 T1954K probably benign Het
Padi2 T C 4: 140,933,217 V336A probably damaging Het
Phf21a C T 2: 92,360,379 Q675* probably null Het
Ppip5k1 T C 2: 121,321,750 E1092G probably damaging Het
Psg21 T C 7: 18,654,861 N102S probably damaging Het
Ralgapa1 C A 12: 55,820,723 Q15H possibly damaging Het
Rbm26 A T 14: 105,160,607 D26E unknown Het
Rbp4 T C 19: 38,124,061 Y152C probably damaging Het
Recql4 A G 15: 76,706,424 V646A possibly damaging Het
Rnf220 A T 4: 117,285,882 M63K probably benign Het
Selenok T C 14: 29,970,067 S21P probably damaging Het
Senp1 A G 15: 98,058,326 V404A probably benign Het
Sh3yl1 A G 12: 30,940,166 probably null Het
Snx32 A G 19: 5,496,990 L275P probably damaging Het
Ssfa2 T A 2: 79,635,660 S41T probably damaging Het
Stat5a T C 11: 100,879,693 V519A possibly damaging Het
Tdrd6 A G 17: 43,625,174 V1661A probably benign Het
Tmem63a T A 1: 180,961,149 F350L probably damaging Het
Trio A T 15: 27,898,000 I401K unknown Het
Ttn T C 2: 76,716,829 E32291G probably damaging Het
Tubgcp5 G T 7: 55,829,407 V1002L probably benign Het
Vav3 C T 3: 109,525,924 T410I possibly damaging Het
Vmn1r1 A T 1: 182,158,032 F23I probably benign Het
Vmn2r84 T A 10: 130,391,072 Q299L probably damaging Het
Vmn2r85 T A 10: 130,422,688 E499D probably benign Het
Other mutations in Tbc1d10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Tbc1d10b APN 7 127199081 missense probably damaging 0.97
R0318:Tbc1d10b UTSW 7 127199034 missense probably damaging 1.00
R1480:Tbc1d10b UTSW 7 127203778 missense probably benign
R1793:Tbc1d10b UTSW 7 127203758 missense possibly damaging 0.48
R1971:Tbc1d10b UTSW 7 127207864 missense probably benign 0.37
R2520:Tbc1d10b UTSW 7 127200283 critical splice donor site probably null
R3887:Tbc1d10b UTSW 7 127199795 missense possibly damaging 0.53
R5517:Tbc1d10b UTSW 7 127198607 missense possibly damaging 0.93
R5780:Tbc1d10b UTSW 7 127198753 missense possibly damaging 0.58
R5912:Tbc1d10b UTSW 7 127199861 missense probably damaging 0.99
R6151:Tbc1d10b UTSW 7 127207996 missense probably damaging 1.00
R6358:Tbc1d10b UTSW 7 127203412 missense probably benign 0.02
R6480:Tbc1d10b UTSW 7 127198878 missense probably damaging 0.99
R7731:Tbc1d10b UTSW 7 127198821 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCAGACACTTAACACTGCTTG -3'
(R):5'- GCAGTACCTGTCTAATAGCAAGG -3'

Sequencing Primer
(F):5'- AACACTGCTTGACTTTCAACTG -3'
(R):5'- GTACCTGTCTAATAGCAAGGAACTC -3'
Posted On2019-05-15