Incidental Mutation 'R7075:Fam53b'
ID549162
Institutional Source Beutler Lab
Gene Symbol Fam53b
Ensembl Gene ENSMUSG00000030956
Gene Namefamily with sequence similarity 53, member B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7075 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location132712082-132813886 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 132759623 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 225 (D225E)
Ref Sequence ENSEMBL: ENSMUSP00000070763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065371] [ENSMUST00000097998] [ENSMUST00000097999] [ENSMUST00000106165] [ENSMUST00000106166] [ENSMUST00000106168] [ENSMUST00000106169] [ENSMUST00000124096] [ENSMUST00000134946]
Predicted Effect probably damaging
Transcript: ENSMUST00000065371
AA Change: D225E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070763
Gene: ENSMUSG00000030956
AA Change: D225E

DomainStartEndE-ValueType
Pfam:FAM53 1 303 6.4e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097998
SMART Domains Protein: ENSMUSP00000095607
Gene: ENSMUSG00000030956

DomainStartEndE-ValueType
Pfam:FAM53 1 57 1.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097999
AA Change: D225E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095608
Gene: ENSMUSG00000030956
AA Change: D225E

DomainStartEndE-ValueType
Pfam:FAM53 1 303 6.4e-121 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106165
AA Change: D225E

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101771
Gene: ENSMUSG00000030956
AA Change: D225E

DomainStartEndE-ValueType
Pfam:FAM53 1 303 4.2e-121 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106166
AA Change: D225E

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101772
Gene: ENSMUSG00000030956
AA Change: D225E

DomainStartEndE-ValueType
Pfam:FAM53 1 303 4.2e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106168
AA Change: D195E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101774
Gene: ENSMUSG00000030956
AA Change: D195E

DomainStartEndE-ValueType
Pfam:FAM53 1 273 1.2e-112 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106169
AA Change: D225E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101775
Gene: ENSMUSG00000030956
AA Change: D225E

DomainStartEndE-ValueType
Pfam:FAM53 1 303 2.3e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134946
SMART Domains Protein: ENSMUSP00000118953
Gene: ENSMUSG00000030956

DomainStartEndE-ValueType
Pfam:FAM53 1 65 1e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (60/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp1 A T 12: 85,279,008 H72Q unknown Het
Afmid T A 11: 117,835,705 D218E probably benign Het
Ankhd1 T C 18: 36,559,989 V1A Het
Atf7ip T C 6: 136,596,515 probably null Het
BC024139 C T 15: 76,124,399 V326I probably benign Het
Bfsp1 T A 2: 143,848,965 Q159L probably damaging Het
Cct2 A T 10: 117,061,465 W125R unknown Het
Cnksr3 G T 10: 7,152,931 T147K probably benign Het
Colq C G 14: 31,552,909 G101R probably damaging Het
Dlg5 G T 14: 24,177,797 T352K possibly damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Ebna1bp2 T C 4: 118,622,102 V119A probably benign Het
Eif2ak4 C T 2: 118,420,810 Q318* probably null Het
Eif2b1 G A 5: 124,571,251 T286M probably damaging Het
Fh1 A G 1: 175,607,855 I354T probably benign Het
Fnbp1 T C 2: 31,058,914 H206R probably benign Het
Gabrg3 A T 7: 57,323,696 D74E probably damaging Het
Galnt18 A T 7: 111,556,388 V246E possibly damaging Het
Glt6d1 T C 2: 25,795,280 R44G probably benign Het
Gm17087 T C 17: 8,566,803 M23V probably benign Het
Gpr160 A T 3: 30,896,777 I333L possibly damaging Het
Hars T C 18: 36,772,355 N142S possibly damaging Het
Hmgcll1 T C 9: 76,056,552 V97A possibly damaging Het
Itih4 T G 14: 30,892,603 V474G probably damaging Het
Keap1 C T 9: 21,231,256 V568I probably benign Het
Kifc5b A G 17: 26,925,898 M633V probably benign Het
Lsm4 A G 8: 70,677,785 E18G probably damaging Het
Meox1 T A 11: 101,893,743 Q88L probably damaging Het
Mettl25 T C 10: 105,829,924 N147S possibly damaging Het
Mphosph9 A C 5: 124,320,859 W83G probably damaging Het
Olfr1006 T A 2: 85,674,824 Y109F Het
Olfr1098 T G 2: 86,922,646 K295N possibly damaging Het
Olfr344 T C 2: 36,569,180 I194T probably benign Het
Olfr862 T A 9: 19,884,063 M81L probably benign Het
Olfr878 T C 9: 37,919,074 V139A probably benign Het
Olfr992 T C 2: 85,400,200 D111G probably damaging Het
Otogl G T 10: 107,778,929 T1954K probably benign Het
Padi2 T C 4: 140,933,217 V336A probably damaging Het
Phf21a C T 2: 92,360,379 Q675* probably null Het
Ppip5k1 T C 2: 121,321,750 E1092G probably damaging Het
Psg21 T C 7: 18,654,861 N102S probably damaging Het
Ralgapa1 C A 12: 55,820,723 Q15H possibly damaging Het
Rbm26 A T 14: 105,160,607 D26E unknown Het
Rbp4 T C 19: 38,124,061 Y152C probably damaging Het
Recql4 A G 15: 76,706,424 V646A possibly damaging Het
Rnf220 A T 4: 117,285,882 M63K probably benign Het
Selenok T C 14: 29,970,067 S21P probably damaging Het
Senp1 A G 15: 98,058,326 V404A probably benign Het
Sh3yl1 A G 12: 30,940,166 probably null Het
Snx32 A G 19: 5,496,990 L275P probably damaging Het
Ssfa2 T A 2: 79,635,660 S41T probably damaging Het
Stat5a T C 11: 100,879,693 V519A possibly damaging Het
Tbc1d10b A T 7: 127,203,238 V388E possibly damaging Het
Tdrd6 A G 17: 43,625,174 V1661A probably benign Het
Tmem63a T A 1: 180,961,149 F350L probably damaging Het
Trio A T 15: 27,898,000 I401K unknown Het
Ttn T C 2: 76,716,829 E32291G probably damaging Het
Tubgcp5 G T 7: 55,829,407 V1002L probably benign Het
Vav3 C T 3: 109,525,924 T410I possibly damaging Het
Vmn1r1 A T 1: 182,158,032 F23I probably benign Het
Vmn2r84 T A 10: 130,391,072 Q299L probably damaging Het
Vmn2r85 T A 10: 130,422,688 E499D probably benign Het
Other mutations in Fam53b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Fam53b APN 7 132715782 missense probably damaging 0.99
PIT4402001:Fam53b UTSW 7 132760017 missense probably damaging 1.00
R1923:Fam53b UTSW 7 132715792 missense probably damaging 0.98
R3712:Fam53b UTSW 7 132759925 missense probably damaging 1.00
R5000:Fam53b UTSW 7 132716001 missense probably benign 0.43
R5102:Fam53b UTSW 7 132715955 nonsense probably null
R5122:Fam53b UTSW 7 132779262 start gained probably benign
R5700:Fam53b UTSW 7 132760020 missense probably damaging 1.00
R5810:Fam53b UTSW 7 132760164 missense probably damaging 1.00
R6186:Fam53b UTSW 7 132715716 missense possibly damaging 0.55
R7125:Fam53b UTSW 7 132771628 missense probably damaging 1.00
R7286:Fam53b UTSW 7 132759661 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGAGAAGGTCTTTGCTCCTGC -3'
(R):5'- GATGAGATGTCCAGTTGCCG -3'

Sequencing Primer
(F):5'- TGCACTTCATCCGGACGC -3'
(R):5'- TACTCCAATGGCGTCAGC -3'
Posted On2019-05-15