Incidental Mutation 'R0613:Rab3il1'
Institutional Source Beutler Lab
Gene Symbol Rab3il1
Ensembl Gene ENSMUSG00000024663
Gene NameRAB3A interacting protein (rabin3)-like 1
Synonyms1200014K04Rik, Rab3ail1
MMRRC Submission 038802-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0613 (G1)
Quality Score225
Status Validated
Chromosomal Location10001669-10038380 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10028364 bp
Amino Acid Change Leucine to Proline at position 174 (L174P)
Ref Sequence ENSEMBL: ENSMUSP00000121449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113161] [ENSMUST00000117641] [ENSMUST00000121418] [ENSMUST00000131407] [ENSMUST00000137637] [ENSMUST00000144788] [ENSMUST00000149967]
Predicted Effect probably damaging
Transcript: ENSMUST00000113161
AA Change: L174P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108786
Gene: ENSMUSG00000024663
AA Change: L174P

Pfam:Sec2p 90 173 2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117641
SMART Domains Protein: ENSMUSP00000113551
Gene: ENSMUSG00000024663

Pfam:Sec2p 89 158 1.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121418
AA Change: L105P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113828
Gene: ENSMUSG00000024663
AA Change: L105P

Pfam:Sec2p 20 129 4.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129882
Predicted Effect probably benign
Transcript: ENSMUST00000131407
SMART Domains Protein: ENSMUSP00000115976
Gene: ENSMUSG00000024663

Pfam:Sec2p 20 86 7.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137637
SMART Domains Protein: ENSMUSP00000120366
Gene: ENSMUSG00000024663

Pfam:Sec2p 20 58 5.9e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144788
AA Change: L174P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121449
Gene: ENSMUSG00000024663
AA Change: L174P

Pfam:Sec2p 89 198 4.4e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149967
SMART Domains Protein: ENSMUSP00000120401
Gene: ENSMUSG00000024663

Pfam:Sec2p 20 51 3.2e-11 PFAM
Meta Mutation Damage Score 0.1104 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor for the ras-related protein Rab3A. The encoded protein binds Rab3a and the inositol hexakisphosphate kinase InsP6K1. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acd A T 8: 105,700,568 probably null Het
Adcy9 A G 16: 4,419,539 S3P probably damaging Het
Adgrl4 T C 3: 151,543,222 probably benign Het
Aff3 T C 1: 38,209,923 E700G probably benign Het
Ahctf1 A G 1: 179,769,414 S56P probably damaging Het
Atp12a T A 14: 56,374,521 I384N probably damaging Het
Brca1 A T 11: 101,508,210 S1519T probably benign Het
Ccl25 T C 8: 4,349,850 V94A probably benign Het
Cep170 T C 1: 176,774,680 T287A probably benign Het
Ces1a A G 8: 93,025,581 S383P probably benign Het
Cntnap3 A T 13: 64,758,414 F793I probably damaging Het
Ctsm T C 13: 61,539,682 R89G probably damaging Het
Cyp2j12 T G 4: 96,102,079 T417P probably damaging Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Edn2 T A 4: 120,161,864 probably null Het
Emc1 T A 4: 139,375,072 probably benign Het
Fam189a2 T A 19: 23,986,489 N239Y probably damaging Het
Fras1 T C 5: 96,700,488 probably benign Het
Fsip2 A T 2: 82,993,795 D6624V probably damaging Het
Gpr107 A G 2: 31,178,285 Y253C probably damaging Het
Gpr108 A G 17: 57,238,174 probably benign Het
Grik1 A G 16: 88,051,333 probably null Het
Gtf3c1 G A 7: 125,644,134 P1766L possibly damaging Het
Gucy2c A T 6: 136,760,723 N293K probably damaging Het
Hps6 C A 19: 46,003,821 P66T probably benign Het
Hspa9 A T 18: 34,947,980 V216E probably damaging Het
Igsf8 T A 1: 172,317,589 M224K probably benign Het
Igsf9b T C 9: 27,326,920 V569A probably damaging Het
Itgb4 A T 11: 115,993,342 I952F probably damaging Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Khdrbs2 A G 1: 32,657,522 H344R possibly damaging Het
Kmo C A 1: 175,637,892 R71S probably damaging Het
Lrrc31 A G 3: 30,685,035 probably benign Het
Map1b T A 13: 99,441,641 D168V probably damaging Het
Mfsd6 T C 1: 52,658,696 probably benign Het
Mgst1 G A 6: 138,156,245 G186D probably damaging Het
Mrc1 C T 2: 14,294,819 A740V probably damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mtor T C 4: 148,526,046 Y1605H possibly damaging Het
Ncoa4 T A 14: 32,176,552 L443Q probably damaging Het
Nelfa G A 5: 33,903,463 probably benign Het
Nepn T A 10: 52,401,257 L363Q probably damaging Het
Nfat5 A G 8: 107,366,295 T630A possibly damaging Het
Nipal4 A T 11: 46,150,384 V328E probably benign Het
Olfr1228 A T 2: 89,249,125 C178S probably damaging Het
Olfr1391 T A 11: 49,327,748 S112R possibly damaging Het
Olfr462 A T 11: 87,889,227 V223E possibly damaging Het
Olfr747 T A 14: 50,681,404 I77F probably benign Het
Olfr809 T A 10: 129,776,262 M116K probably damaging Het
Olfr924 T A 9: 38,848,613 C166* probably null Het
Otogl A T 10: 107,817,070 N1140K probably damaging Het
Ppip5k2 A C 1: 97,752,740 Y236* probably null Het
Prelid1 C T 13: 55,324,343 R111* probably null Het
Prpf8 T C 11: 75,503,444 L1771P probably damaging Het
Ptprb A T 10: 116,302,325 Y378F possibly damaging Het
Ptprb A G 10: 116,302,378 T396A possibly damaging Het
Rab4a T C 8: 123,823,835 V18A possibly damaging Het
Scn3a T A 2: 65,472,284 M1273L possibly damaging Het
Sdhc A T 1: 171,129,844 V156E probably benign Het
Slco3a1 T C 7: 74,346,634 probably benign Het
Syne3 T C 12: 104,958,112 T343A probably benign Het
Syt11 A G 3: 88,762,469 C39R probably damaging Het
Tll2 G T 19: 41,104,990 D462E probably damaging Het
Tmem132e T A 11: 82,438,338 V481D probably damaging Het
Tmem161b C T 13: 84,251,320 L17F probably damaging Het
Vmn2r105 T A 17: 20,208,316 I833F probably damaging Het
Vstm2a A T 11: 16,263,140 N175I probably damaging Het
Xpnpep1 G T 19: 53,006,353 D238E probably damaging Het
Zfp112 G A 7: 24,127,028 G807D probably benign Het
Zfp518b A T 5: 38,673,603 V353E probably damaging Het
Zfp69 T C 4: 120,934,347 E39G probably benign Het
Zfp865 A G 7: 5,029,091 H25R possibly damaging Het
Other mutations in Rab3il1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4737:Rab3il1 UTSW 19 10033751 missense probably damaging 1.00
R0324:Rab3il1 UTSW 19 10028289 missense probably damaging 1.00
R0648:Rab3il1 UTSW 19 10027388 small insertion probably benign
R3752:Rab3il1 UTSW 19 10030477 missense probably benign 0.05
R3765:Rab3il1 UTSW 19 10028309 missense probably damaging 1.00
R4062:Rab3il1 UTSW 19 10026624 missense probably benign
R4245:Rab3il1 UTSW 19 10030154 missense probably damaging 1.00
R4803:Rab3il1 UTSW 19 10027444 missense possibly damaging 0.78
R4820:Rab3il1 UTSW 19 10026670 missense probably benign 0.01
R7744:Rab3il1 UTSW 19 10028277 splice site probably null
R8047:Rab3il1 UTSW 19 10033802 missense probably benign 0.03
R8154:Rab3il1 UTSW 19 10027572 missense possibly damaging 0.83
R8812:Rab3il1 UTSW 19 10026777 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- agaggttgttccaagggtaag -3'
Posted On2013-07-11