Incidental Mutation 'R7075:Hars'
ID549192
Institutional Source Beutler Lab
Gene Symbol Hars
Ensembl Gene ENSMUSG00000001380
Gene Namehistidyl-tRNA synthetase
SynonymsMMHRS
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R7075 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location36766530-36783205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36772355 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 142 (N142S)
Ref Sequence ENSEMBL: ENSMUSP00000001416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001416]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001416
AA Change: N142S

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000001416
Gene: ENSMUSG00000001380
AA Change: N142S

DomainStartEndE-ValueType
WHEP-TRS 7 60 5.37e-11 SMART
Pfam:tRNA-synt_His 61 389 1.9e-41 PFAM
Pfam:HGTP_anticodon2 404 507 3.3e-12 PFAM
Pfam:HGTP_anticodon 410 501 4.4e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (60/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a cytoplasmic enzyme which belongs to the class II family of aminoacyl-tRNA synthetases. The enzyme is responsible for the synthesis of histidyl-transfer RNA, which is essential for the incorporation of histidine into proteins. The gene is located in a head-to-head orientation with HARSL on chromosome five, where the homologous genes share a bidirectional promoter. The gene product is a frequent target of autoantibodies in the human autoimmune disease polymyositis/dermatomyositis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp1 A T 12: 85,279,008 H72Q unknown Het
Afmid T A 11: 117,835,705 D218E probably benign Het
Ankhd1 T C 18: 36,559,989 V1A Het
Atf7ip T C 6: 136,596,515 probably null Het
BC024139 C T 15: 76,124,399 V326I probably benign Het
Bfsp1 T A 2: 143,848,965 Q159L probably damaging Het
Cct2 A T 10: 117,061,465 W125R unknown Het
Cnksr3 G T 10: 7,152,931 T147K probably benign Het
Colq C G 14: 31,552,909 G101R probably damaging Het
Dlg5 G T 14: 24,177,797 T352K possibly damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Ebna1bp2 T C 4: 118,622,102 V119A probably benign Het
Eif2ak4 C T 2: 118,420,810 Q318* probably null Het
Eif2b1 G A 5: 124,571,251 T286M probably damaging Het
Fam53b G T 7: 132,759,623 D225E probably damaging Het
Fh1 A G 1: 175,607,855 I354T probably benign Het
Fnbp1 T C 2: 31,058,914 H206R probably benign Het
Gabrg3 A T 7: 57,323,696 D74E probably damaging Het
Galnt18 A T 7: 111,556,388 V246E possibly damaging Het
Glt6d1 T C 2: 25,795,280 R44G probably benign Het
Gm17087 T C 17: 8,566,803 M23V probably benign Het
Gpr160 A T 3: 30,896,777 I333L possibly damaging Het
Hmgcll1 T C 9: 76,056,552 V97A possibly damaging Het
Itih4 T G 14: 30,892,603 V474G probably damaging Het
Keap1 C T 9: 21,231,256 V568I probably benign Het
Kifc5b A G 17: 26,925,898 M633V probably benign Het
Lsm4 A G 8: 70,677,785 E18G probably damaging Het
Meox1 T A 11: 101,893,743 Q88L probably damaging Het
Mettl25 T C 10: 105,829,924 N147S possibly damaging Het
Mphosph9 A C 5: 124,320,859 W83G probably damaging Het
Olfr1006 T A 2: 85,674,824 Y109F Het
Olfr1098 T G 2: 86,922,646 K295N possibly damaging Het
Olfr344 T C 2: 36,569,180 I194T probably benign Het
Olfr862 T A 9: 19,884,063 M81L probably benign Het
Olfr878 T C 9: 37,919,074 V139A probably benign Het
Olfr992 T C 2: 85,400,200 D111G probably damaging Het
Otogl G T 10: 107,778,929 T1954K probably benign Het
Padi2 T C 4: 140,933,217 V336A probably damaging Het
Phf21a C T 2: 92,360,379 Q675* probably null Het
Ppip5k1 T C 2: 121,321,750 E1092G probably damaging Het
Psg21 T C 7: 18,654,861 N102S probably damaging Het
Ralgapa1 C A 12: 55,820,723 Q15H possibly damaging Het
Rbm26 A T 14: 105,160,607 D26E unknown Het
Rbp4 T C 19: 38,124,061 Y152C probably damaging Het
Recql4 A G 15: 76,706,424 V646A possibly damaging Het
Rnf220 A T 4: 117,285,882 M63K probably benign Het
Selenok T C 14: 29,970,067 S21P probably damaging Het
Senp1 A G 15: 98,058,326 V404A probably benign Het
Sh3yl1 A G 12: 30,940,166 probably null Het
Snx32 A G 19: 5,496,990 L275P probably damaging Het
Ssfa2 T A 2: 79,635,660 S41T probably damaging Het
Stat5a T C 11: 100,879,693 V519A possibly damaging Het
Tbc1d10b A T 7: 127,203,238 V388E possibly damaging Het
Tdrd6 A G 17: 43,625,174 V1661A probably benign Het
Tmem63a T A 1: 180,961,149 F350L probably damaging Het
Trio A T 15: 27,898,000 I401K unknown Het
Ttn T C 2: 76,716,829 E32291G probably damaging Het
Tubgcp5 G T 7: 55,829,407 V1002L probably benign Het
Vav3 C T 3: 109,525,924 T410I possibly damaging Het
Vmn1r1 A T 1: 182,158,032 F23I probably benign Het
Vmn2r84 T A 10: 130,391,072 Q299L probably damaging Het
Vmn2r85 T A 10: 130,422,688 E499D probably benign Het
Other mutations in Hars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Hars APN 18 36768172 missense probably damaging 1.00
IGL01993:Hars APN 18 36770212 missense probably damaging 1.00
IGL03079:Hars APN 18 36770503 missense probably damaging 1.00
P0040:Hars UTSW 18 36773575 missense probably damaging 0.99
R0542:Hars UTSW 18 36771181 missense probably benign 0.23
R0630:Hars UTSW 18 36771389 missense probably damaging 1.00
R1171:Hars UTSW 18 36771414 missense possibly damaging 0.81
R1711:Hars UTSW 18 36771103 missense probably damaging 1.00
R1744:Hars UTSW 18 36770832 missense probably benign 0.00
R1873:Hars UTSW 18 36767241 missense probably damaging 0.99
R3907:Hars UTSW 18 36782716 missense probably benign 0.00
R5193:Hars UTSW 18 36767305 missense possibly damaging 0.94
R5688:Hars UTSW 18 36772316 missense probably damaging 1.00
R6331:Hars UTSW 18 36771332 missense probably benign 0.19
R6349:Hars UTSW 18 36783054 missense probably benign 0.00
R6416:Hars UTSW 18 36773590 missense possibly damaging 0.95
R7209:Hars UTSW 18 36773540 missense probably benign 0.14
R7409:Hars UTSW 18 36770113 missense probably damaging 1.00
R7538:Hars UTSW 18 36771141 missense probably benign 0.00
R7621:Hars UTSW 18 36770423 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCCATTAGGAGGTCTACATGC -3'
(R):5'- CTTCCTGACAATGAGACGCG -3'

Sequencing Primer
(F):5'- GAGCATTTTTGAGACCATCCAGTG -3'
(R):5'- ACAATGAGACGCGCTGTTTC -3'
Posted On2019-05-15