Incidental Mutation 'R7076:Srp14'
ID549200
Institutional Source Beutler Lab
Gene Symbol Srp14
Ensembl Gene ENSMUSG00000009549
Gene Namesignal recognition particle 14
Synonyms(homologous Alu RNA binding protein), 14kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.721) question?
Stock #R7076 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location118475850-118479711 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118479390 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 29 (T29A)
Ref Sequence ENSEMBL: ENSMUSP00000009693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005233] [ENSMUST00000009693] [ENSMUST00000102527] [ENSMUST00000110862] [ENSMUST00000110870] [ENSMUST00000110872] [ENSMUST00000110874]
PDB Structure
SIGNAL RECOGNITION PARTICLE ALU RNA BINDING HETERODIMER, SRP9/14 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000005233
SMART Domains Protein: ENSMUSP00000005233
Gene: ENSMUSG00000005102

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
RWD 25 137 3.42e-38 SMART
coiled coil region 146 205 N/A INTRINSIC
Pfam:Pkinase 323 538 4.6e-27 PFAM
Pfam:Pkinase_Tyr 326 535 5.5e-18 PFAM
Pfam:Pkinase 589 663 1.7e-11 PFAM
Pfam:Pkinase_Tyr 589 663 1.2e-5 PFAM
low complexity region 728 738 N/A INTRINSIC
Pfam:Pkinase 781 1000 2.6e-38 PFAM
Pfam:Pkinase_Tyr 786 998 1.8e-18 PFAM
Pfam:tRNA-synt_His 1054 1380 5.7e-18 PFAM
Pfam:HGTP_anticodon2 1392 1647 5.8e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000009693
AA Change: T29A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000009693
Gene: ENSMUSG00000009549
AA Change: T29A

DomainStartEndE-ValueType
Pfam:SRP14 4 94 5.5e-31 PFAM
low complexity region 95 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102527
SMART Domains Protein: ENSMUSP00000099586
Gene: ENSMUSG00000005102

DomainStartEndE-ValueType
coiled coil region 34 93 N/A INTRINSIC
Pfam:Pkinase 211 426 1.6e-22 PFAM
Pfam:Pkinase_Tyr 215 423 6.8e-18 PFAM
Pfam:Pkinase_Tyr 477 551 1.2e-5 PFAM
Pfam:Pkinase 477 552 3.9e-11 PFAM
low complexity region 616 626 N/A INTRINSIC
Pfam:Pkinase 647 888 9.4e-42 PFAM
Pfam:Pkinase_Tyr 672 886 1.4e-19 PFAM
Pfam:tRNA-synt_His 941 1268 4.8e-19 PFAM
Pfam:HGTP_anticodon2 1280 1535 1e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110862
AA Change: T29A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106486
Gene: ENSMUSG00000009549
AA Change: T29A

DomainStartEndE-ValueType
Pfam:SRP14 4 96 8.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110870
SMART Domains Protein: ENSMUSP00000106494
Gene: ENSMUSG00000005102

DomainStartEndE-ValueType
Pfam:Pkinase 45 260 3.3e-22 PFAM
Pfam:Pkinase_Tyr 47 257 1.3e-17 PFAM
Pfam:Pkinase_Tyr 311 385 2.5e-5 PFAM
Pfam:Pkinase 311 386 8e-11 PFAM
low complexity region 450 460 N/A INTRINSIC
Pfam:Pkinase 481 722 1.9e-41 PFAM
Pfam:Pkinase_Tyr 506 720 2.8e-19 PFAM
Pfam:tRNA-synt_His 775 1102 8.7e-19 PFAM
Pfam:HGTP_anticodon2 1114 1369 1.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110872
SMART Domains Protein: ENSMUSP00000106496
Gene: ENSMUSG00000005102

DomainStartEndE-ValueType
coiled coil region 25 84 N/A INTRINSIC
Pfam:Pkinase 202 417 3.8e-22 PFAM
Pfam:Pkinase_Tyr 206 414 1.6e-17 PFAM
Pfam:Pkinase_Tyr 468 542 2.8e-5 PFAM
Pfam:Pkinase 468 543 9.1e-11 PFAM
low complexity region 607 617 N/A INTRINSIC
Pfam:Pkinase 638 879 2.2e-41 PFAM
Pfam:Pkinase_Tyr 663 877 3.3e-19 PFAM
Pfam:tRNA-synt_His 932 1259 1.1e-18 PFAM
Pfam:HGTP_anticodon2 1271 1526 2.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110874
SMART Domains Protein: ENSMUSP00000106498
Gene: ENSMUSG00000005102

DomainStartEndE-ValueType
Pfam:RWD 8 56 6.4e-8 PFAM
coiled coil region 68 127 N/A INTRINSIC
Pfam:Pkinase 245 460 1.1e-22 PFAM
Pfam:Pkinase_Tyr 247 457 4.2e-18 PFAM
Pfam:Pkinase_Tyr 511 585 7.8e-6 PFAM
Pfam:Pkinase 511 586 2.5e-11 PFAM
low complexity region 650 660 N/A INTRINSIC
Pfam:Pkinase 681 922 6.2e-42 PFAM
Pfam:Pkinase_Tyr 706 920 9.3e-20 PFAM
Pfam:tRNA-synt_His 975 1302 3.8e-19 PFAM
Pfam:HGTP_anticodon2 1314 1569 5.4e-17 PFAM
Meta Mutation Damage Score 0.6688 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 A G 8: 55,871,659 C587R probably damaging Het
Adgrg7 T C 16: 56,742,406 T523A probably damaging Het
Arrdc3 A T 13: 80,890,696 K259M probably damaging Het
Becn1 A T 11: 101,295,324 N151K probably benign Het
Cars2 C T 8: 11,529,649 E270K probably damaging Het
Ccp110 C A 7: 118,732,405 P943Q probably damaging Het
Ccser2 A G 14: 36,939,829 I466T probably benign Het
Cd164 A G 10: 41,523,197 E94G probably benign Het
Cdon C T 9: 35,504,150 T1228I probably benign Het
Cubn C A 2: 13,306,280 V3145L probably benign Het
Cubn T A 2: 13,306,281 K3144N probably benign Het
Dchs1 A G 7: 105,761,871 V1649A probably benign Het
Dgka A T 10: 128,733,583 D153E probably damaging Het
Dip2b A G 15: 100,157,972 probably null Het
Dnajc21 T C 15: 10,449,631 T435A probably benign Het
F830016B08Rik A T 18: 60,300,471 I209F probably damaging Het
Ghdc C A 11: 100,769,714 S111I possibly damaging Het
Gm19965 T C 1: 116,821,275 C229R Het
Gpm6a C T 8: 55,037,451 T54I probably damaging Het
Gpr171 G T 3: 59,098,156 A66E probably damaging Het
Grm7 A G 6: 111,358,152 D508G probably benign Het
Has1 G A 17: 17,843,806 R524C probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv3-8 A T 12: 114,322,782 L7Q probably damaging Het
Ints10 A T 8: 68,796,751 R78* probably null Het
Itpr1 A G 6: 108,388,296 I903V probably benign Het
Lrp1 A G 10: 127,550,183 probably null Het
Mki67 A G 7: 135,705,629 V132A probably damaging Het
Myh4 A G 11: 67,253,173 E1123G possibly damaging Het
Neurog3 A G 10: 62,133,580 T40A probably benign Het
Nipsnap3b T A 4: 53,021,095 probably null Het
Nr4a3 G A 4: 48,055,957 V328I probably damaging Het
Olfr1489 G T 19: 13,633,880 M256I possibly damaging Het
Olfr313 G A 11: 58,817,164 R52Q probably benign Het
Olfr487 A T 7: 108,211,998 V177D probably damaging Het
Olfr654 A T 7: 104,588,223 S140C probably damaging Het
Olfr716 T C 7: 107,148,029 F238L probably damaging Het
Olfr743 T A 14: 50,533,821 Y136* probably null Het
Osbpl5 A G 7: 143,709,840 L102P probably benign Het
Ppl C T 16: 5,100,119 R503Q probably damaging Het
Ppp2r2d T C 7: 138,876,597 M321T possibly damaging Het
Prex1 T C 2: 166,633,382 Y197C probably damaging Het
Prss32 A G 17: 23,853,921 D42G possibly damaging Het
Ralgapa1 T C 12: 55,721,576 E1210G possibly damaging Het
Sdr16c5 A G 4: 4,006,591 C234R probably damaging Het
Slc23a4 A G 6: 34,956,884 S95P probably damaging Het
Tet2 T A 3: 133,467,023 H1826L possibly damaging Het
Tfr2 A T 5: 137,583,574 Y641F probably damaging Het
Tmco5b A G 2: 113,287,421 N27D probably damaging Het
Tvp23a T C 16: 10,428,735 D62G probably benign Het
Usp12 A G 5: 146,737,752 F347S possibly damaging Het
Zfp407 A T 18: 84,558,476 L1504Q probably damaging Het
Zfp524 A G 7: 5,017,896 D141G possibly damaging Het
Zfp68 A G 5: 138,606,939 I374T possibly damaging Het
Zfp758 C T 17: 22,375,156 H208Y probably benign Het
Zfp804b T C 5: 6,769,751 H1104R probably benign Het
Znrf2 T A 6: 54,842,695 *75K probably null Het
Zzef1 T C 11: 72,899,559 V2113A probably benign Het
Other mutations in Srp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3712:Srp14 UTSW 2 118478959 missense probably null 0.01
Predicted Primers PCR Primer
(F):5'- TCTTCCTCACTAACGGAGCG -3'
(R):5'- CGAGTTTTCCGGCTGTAACC -3'

Sequencing Primer
(F):5'- ACTAACGGAGCGGGGGC -3'
(R):5'- TGTAACCGCTGGAGGCTTC -3'
Posted On2019-05-15