Incidental Mutation 'R7076:Sdr16c5'
ID549204
Institutional Source Beutler Lab
Gene Symbol Sdr16c5
Ensembl Gene ENSMUSG00000028236
Gene Nameshort chain dehydrogenase/reductase family 16C, member 5
SynonymsRdhe2, Scdr9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R7076 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location3995936-4019663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4006591 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 234 (C234R)
Ref Sequence ENSEMBL: ENSMUSP00000046298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040925]
Predicted Effect probably damaging
Transcript: ENSMUST00000040925
AA Change: C234R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046298
Gene: ENSMUSG00000028236
AA Change: C234R

DomainStartEndE-ValueType
Pfam:KR 41 233 1.8e-17 PFAM
Pfam:adh_short 41 238 1.7e-48 PFAM
Pfam:adh_short_C2 47 228 1.3e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain alcohol dehydrogenase/reductase superfamily of proteins and is involved in the oxidation of retinol to retinaldehyde. The encoded protein is associated with the endoplasmic reticulum and is predicted to contain three transmembrane helices, suggesting that it is an integral membrane protein. It recognizes all-trans-retinol and all-trans-retinaldehyde as substrates and exhibits a strong preference for NAD(+)/NADH as cofactors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 A G 8: 55,871,659 C587R probably damaging Het
Adgrg7 T C 16: 56,742,406 T523A probably damaging Het
Arrdc3 A T 13: 80,890,696 K259M probably damaging Het
Becn1 A T 11: 101,295,324 N151K probably benign Het
Cars2 C T 8: 11,529,649 E270K probably damaging Het
Ccp110 C A 7: 118,732,405 P943Q probably damaging Het
Ccser2 A G 14: 36,939,829 I466T probably benign Het
Cd164 A G 10: 41,523,197 E94G probably benign Het
Cdon C T 9: 35,504,150 T1228I probably benign Het
Cubn C A 2: 13,306,280 V3145L probably benign Het
Cubn T A 2: 13,306,281 K3144N probably benign Het
Dchs1 A G 7: 105,761,871 V1649A probably benign Het
Dgka A T 10: 128,733,583 D153E probably damaging Het
Dip2b A G 15: 100,157,972 probably null Het
Dnajc21 T C 15: 10,449,631 T435A probably benign Het
F830016B08Rik A T 18: 60,300,471 I209F probably damaging Het
Ghdc C A 11: 100,769,714 S111I possibly damaging Het
Gm19965 T C 1: 116,821,275 C229R Het
Gpm6a C T 8: 55,037,451 T54I probably damaging Het
Gpr171 G T 3: 59,098,156 A66E probably damaging Het
Grm7 A G 6: 111,358,152 D508G probably benign Het
Has1 G A 17: 17,843,806 R524C probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv3-8 A T 12: 114,322,782 L7Q probably damaging Het
Ints10 A T 8: 68,796,751 R78* probably null Het
Itpr1 A G 6: 108,388,296 I903V probably benign Het
Lrp1 A G 10: 127,550,183 probably null Het
Mki67 A G 7: 135,705,629 V132A probably damaging Het
Myh4 A G 11: 67,253,173 E1123G possibly damaging Het
Neurog3 A G 10: 62,133,580 T40A probably benign Het
Nipsnap3b T A 4: 53,021,095 probably null Het
Nr4a3 G A 4: 48,055,957 V328I probably damaging Het
Olfr1489 G T 19: 13,633,880 M256I possibly damaging Het
Olfr313 G A 11: 58,817,164 R52Q probably benign Het
Olfr487 A T 7: 108,211,998 V177D probably damaging Het
Olfr654 A T 7: 104,588,223 S140C probably damaging Het
Olfr716 T C 7: 107,148,029 F238L probably damaging Het
Olfr743 T A 14: 50,533,821 Y136* probably null Het
Osbpl5 A G 7: 143,709,840 L102P probably benign Het
Ppl C T 16: 5,100,119 R503Q probably damaging Het
Ppp2r2d T C 7: 138,876,597 M321T possibly damaging Het
Prex1 T C 2: 166,633,382 Y197C probably damaging Het
Prss32 A G 17: 23,853,921 D42G possibly damaging Het
Ralgapa1 T C 12: 55,721,576 E1210G possibly damaging Het
Slc23a4 A G 6: 34,956,884 S95P probably damaging Het
Srp14 T C 2: 118,479,390 T29A probably damaging Het
Tet2 T A 3: 133,467,023 H1826L possibly damaging Het
Tfr2 A T 5: 137,583,574 Y641F probably damaging Het
Tmco5b A G 2: 113,287,421 N27D probably damaging Het
Tvp23a T C 16: 10,428,735 D62G probably benign Het
Usp12 A G 5: 146,737,752 F347S possibly damaging Het
Zfp407 A T 18: 84,558,476 L1504Q probably damaging Het
Zfp524 A G 7: 5,017,896 D141G possibly damaging Het
Zfp68 A G 5: 138,606,939 I374T possibly damaging Het
Zfp758 C T 17: 22,375,156 H208Y probably benign Het
Zfp804b T C 5: 6,769,751 H1104R probably benign Het
Znrf2 T A 6: 54,842,695 *75K probably null Het
Zzef1 T C 11: 72,899,559 V2113A probably benign Het
Other mutations in Sdr16c5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Sdr16c5 APN 4 4012320 splice site probably benign
IGL02230:Sdr16c5 APN 4 4016354 missense probably damaging 0.99
IGL03090:Sdr16c5 APN 4 4006575 splice site probably benign
PIT4802001:Sdr16c5 UTSW 4 4012423 missense probably damaging 1.00
R0377:Sdr16c5 UTSW 4 4005546 missense probably benign 0.03
R0610:Sdr16c5 UTSW 4 4016116 missense possibly damaging 0.81
R2012:Sdr16c5 UTSW 4 3996244 missense probably benign
R3735:Sdr16c5 UTSW 4 4005614 missense probably benign
R3839:Sdr16c5 UTSW 4 4006601 missense probably damaging 0.96
R3896:Sdr16c5 UTSW 4 4006609 missense probably damaging 1.00
R4824:Sdr16c5 UTSW 4 4016216 nonsense probably null
R5024:Sdr16c5 UTSW 4 4010365 missense probably damaging 1.00
R5194:Sdr16c5 UTSW 4 4006663 missense probably benign 0.16
R5395:Sdr16c5 UTSW 4 4016277 missense probably benign 0.12
R6267:Sdr16c5 UTSW 4 4016162 missense probably damaging 1.00
R6352:Sdr16c5 UTSW 4 4016421 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGATGGGTACTAATTGGGCC -3'
(R):5'- CCAGTCAGACCTGAACACTTTAG -3'

Sequencing Primer
(F):5'- GGGCCTTGTAATCATTATCAATCAGG -3'
(R):5'- AGTCAGACCTGAACACTTTAGCTCTC -3'
Posted On2019-05-15