Incidental Mutation 'R7076:Zfp68'
ID549208
Institutional Source Beutler Lab
Gene Symbol Zfp68
Ensembl Gene ENSMUSG00000058291
Gene Namezinc finger protein 68
SynonymsZfp68, Zfp70, KRAZ2, KRAB3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.841) question?
Stock #R7076 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location138603652-138619761 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138606939 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 374 (I374T)
Ref Sequence ENSEMBL: ENSMUSP00000069615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063262] [ENSMUST00000085852] [ENSMUST00000110905]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063262
AA Change: I374T

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000069615
Gene: ENSMUSG00000058291
AA Change: I374T

DomainStartEndE-ValueType
KRAB 10 70 1.11e-30 SMART
ZnF_C2H2 317 339 1.58e-3 SMART
ZnF_C2H2 345 367 3.16e-3 SMART
ZnF_C2H2 373 395 5.5e-3 SMART
ZnF_C2H2 401 423 2.27e-4 SMART
ZnF_C2H2 429 451 3.44e-4 SMART
ZnF_C2H2 457 479 3.07e-1 SMART
ZnF_C2H2 485 507 2.09e-3 SMART
ZnF_C2H2 513 535 3.29e-1 SMART
ZnF_C2H2 541 563 2.99e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000085852
AA Change: I336T

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000083013
Gene: ENSMUSG00000058291
AA Change: I336T

DomainStartEndE-ValueType
KRAB 1 32 6e-1 SMART
ZnF_C2H2 279 301 1.58e-3 SMART
ZnF_C2H2 307 329 3.16e-3 SMART
ZnF_C2H2 335 357 5.5e-3 SMART
ZnF_C2H2 363 385 2.27e-4 SMART
ZnF_C2H2 391 413 3.44e-4 SMART
ZnF_C2H2 419 441 3.07e-1 SMART
ZnF_C2H2 447 469 2.09e-3 SMART
ZnF_C2H2 475 497 3.29e-1 SMART
ZnF_C2H2 503 525 2.99e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110905
AA Change: I374T

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106530
Gene: ENSMUSG00000058291
AA Change: I374T

DomainStartEndE-ValueType
KRAB 10 70 1.11e-30 SMART
ZnF_C2H2 317 339 1.58e-3 SMART
ZnF_C2H2 345 367 3.16e-3 SMART
ZnF_C2H2 373 395 5.5e-3 SMART
ZnF_C2H2 401 423 2.27e-4 SMART
ZnF_C2H2 429 451 3.44e-4 SMART
ZnF_C2H2 457 479 3.07e-1 SMART
ZnF_C2H2 485 507 2.09e-3 SMART
ZnF_C2H2 513 535 3.29e-1 SMART
ZnF_C2H2 541 563 2.99e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 A G 8: 55,871,659 C587R probably damaging Het
Adgrg7 T C 16: 56,742,406 T523A probably damaging Het
Arrdc3 A T 13: 80,890,696 K259M probably damaging Het
Becn1 A T 11: 101,295,324 N151K probably benign Het
Cars2 C T 8: 11,529,649 E270K probably damaging Het
Ccp110 C A 7: 118,732,405 P943Q probably damaging Het
Ccser2 A G 14: 36,939,829 I466T probably benign Het
Cd164 A G 10: 41,523,197 E94G probably benign Het
Cdon C T 9: 35,504,150 T1228I probably benign Het
Cubn C A 2: 13,306,280 V3145L probably benign Het
Cubn T A 2: 13,306,281 K3144N probably benign Het
Dchs1 A G 7: 105,761,871 V1649A probably benign Het
Dgka A T 10: 128,733,583 D153E probably damaging Het
Dip2b A G 15: 100,157,972 probably null Het
Dnajc21 T C 15: 10,449,631 T435A probably benign Het
F830016B08Rik A T 18: 60,300,471 I209F probably damaging Het
Ghdc C A 11: 100,769,714 S111I possibly damaging Het
Gm19965 T C 1: 116,821,275 C229R Het
Gpm6a C T 8: 55,037,451 T54I probably damaging Het
Gpr171 G T 3: 59,098,156 A66E probably damaging Het
Grm7 A G 6: 111,358,152 D508G probably benign Het
Has1 G A 17: 17,843,806 R524C probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv3-8 A T 12: 114,322,782 L7Q probably damaging Het
Ints10 A T 8: 68,796,751 R78* probably null Het
Itpr1 A G 6: 108,388,296 I903V probably benign Het
Lrp1 A G 10: 127,550,183 probably null Het
Mki67 A G 7: 135,705,629 V132A probably damaging Het
Myh4 A G 11: 67,253,173 E1123G possibly damaging Het
Neurog3 A G 10: 62,133,580 T40A probably benign Het
Nipsnap3b T A 4: 53,021,095 probably null Het
Nr4a3 G A 4: 48,055,957 V328I probably damaging Het
Olfr1489 G T 19: 13,633,880 M256I possibly damaging Het
Olfr313 G A 11: 58,817,164 R52Q probably benign Het
Olfr487 A T 7: 108,211,998 V177D probably damaging Het
Olfr654 A T 7: 104,588,223 S140C probably damaging Het
Olfr716 T C 7: 107,148,029 F238L probably damaging Het
Olfr743 T A 14: 50,533,821 Y136* probably null Het
Osbpl5 A G 7: 143,709,840 L102P probably benign Het
Ppl C T 16: 5,100,119 R503Q probably damaging Het
Ppp2r2d T C 7: 138,876,597 M321T possibly damaging Het
Prex1 T C 2: 166,633,382 Y197C probably damaging Het
Prss32 A G 17: 23,853,921 D42G possibly damaging Het
Ralgapa1 T C 12: 55,721,576 E1210G possibly damaging Het
Sdr16c5 A G 4: 4,006,591 C234R probably damaging Het
Slc23a4 A G 6: 34,956,884 S95P probably damaging Het
Srp14 T C 2: 118,479,390 T29A probably damaging Het
Tet2 T A 3: 133,467,023 H1826L possibly damaging Het
Tfr2 A T 5: 137,583,574 Y641F probably damaging Het
Tmco5b A G 2: 113,287,421 N27D probably damaging Het
Tvp23a T C 16: 10,428,735 D62G probably benign Het
Usp12 A G 5: 146,737,752 F347S possibly damaging Het
Zfp407 A T 18: 84,558,476 L1504Q probably damaging Het
Zfp524 A G 7: 5,017,896 D141G possibly damaging Het
Zfp758 C T 17: 22,375,156 H208Y probably benign Het
Zfp804b T C 5: 6,769,751 H1104R probably benign Het
Znrf2 T A 6: 54,842,695 *75K probably null Het
Zzef1 T C 11: 72,899,559 V2113A probably benign Het
Other mutations in Zfp68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02167:Zfp68 APN 5 138606367 missense probably benign 0.00
R0040:Zfp68 UTSW 5 138607779 missense probably benign 0.24
R0040:Zfp68 UTSW 5 138607779 missense probably benign 0.24
R0152:Zfp68 UTSW 5 138606613 missense probably damaging 1.00
R0390:Zfp68 UTSW 5 138607225 missense probably benign 0.14
R1490:Zfp68 UTSW 5 138606829 missense probably benign 0.16
R4688:Zfp68 UTSW 5 138616481 nonsense probably null
R4992:Zfp68 UTSW 5 138607337 missense possibly damaging 0.50
R5072:Zfp68 UTSW 5 138606317 missense probably benign 0.01
R7117:Zfp68 UTSW 5 138606318 missense probably benign 0.01
R7332:Zfp68 UTSW 5 138606568 missense possibly damaging 0.90
R8399:Zfp68 UTSW 5 138607820 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGTTGTTAGACTGTTTGCTCTCA -3'
(R):5'- AGCATGAGAAGCTCTTTATCCAGAA -3'

Sequencing Primer
(F):5'- CGGTAGAAGGTCTTCATACACTGC -3'
(R):5'- TTCTCAGCAGTCAGAAGTGAGTC -3'
Posted On2019-05-15