Incidental Mutation 'R7076:Zfp524'
ID549213
Institutional Source Beutler Lab
Gene Symbol Zfp524
Ensembl Gene ENSMUSG00000051184
Gene Namezinc finger protein 524
Synonyms2300009P13Rik, 0610012F07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R7076 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location5014415-5018488 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5017896 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 141 (D141G)
Ref Sequence ENSEMBL: ENSMUSP00000083533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076251] [ENSMUST00000077385] [ENSMUST00000085427] [ENSMUST00000086349] [ENSMUST00000165320] [ENSMUST00000167804] [ENSMUST00000207030] [ENSMUST00000207050] [ENSMUST00000207412] [ENSMUST00000207901] [ENSMUST00000207946] [ENSMUST00000208728] [ENSMUST00000208944] [ENSMUST00000209030] [ENSMUST00000209060]
Predicted Effect probably benign
Transcript: ENSMUST00000076251
SMART Domains Protein: ENSMUSP00000075601
Gene: ENSMUSG00000074405

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 62 82 N/A INTRINSIC
low complexity region 120 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
ZnF_C2H2 220 242 1.28e-3 SMART
ZnF_C2H2 248 270 5.5e-3 SMART
low complexity region 274 286 N/A INTRINSIC
low complexity region 294 324 N/A INTRINSIC
ZnF_C2H2 350 372 8.81e-2 SMART
ZnF_C2H2 378 400 6.08e-5 SMART
ZnF_C2H2 407 429 1.79e-2 SMART
ZnF_C2H2 439 461 1.92e-2 SMART
low complexity region 478 495 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 523 542 N/A INTRINSIC
ZnF_C2H2 546 568 4.47e-3 SMART
ZnF_C2H2 574 596 5.42e-2 SMART
ZnF_C2H2 602 624 1.72e-4 SMART
low complexity region 628 660 N/A INTRINSIC
ZnF_C2H2 664 686 5.34e-1 SMART
ZnF_C2H2 692 714 2.82e0 SMART
low complexity region 725 745 N/A INTRINSIC
low complexity region 750 770 N/A INTRINSIC
low complexity region 772 788 N/A INTRINSIC
ZnF_C2H2 791 813 1.64e-1 SMART
ZnF_C2H2 819 841 9.3e-1 SMART
ZnF_C2H2 847 869 2.95e-3 SMART
ZnF_C2H2 875 897 3.83e-2 SMART
ZnF_C2H2 903 925 2.05e-2 SMART
ZnF_C2H2 931 953 1.18e-2 SMART
ZnF_C2H2 959 981 1.36e-2 SMART
ZnF_C2H2 988 1010 5.06e-2 SMART
ZnF_C2H2 1016 1038 4.72e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077385
SMART Domains Protein: ENSMUSP00000076603
Gene: ENSMUSG00000061374

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
ZnF_C2H2 29 51 5.99e-4 SMART
ZnF_C2H2 57 79 6.32e-3 SMART
ZnF_C2H2 85 107 1.36e-2 SMART
ZnF_C2H2 113 136 4.72e-2 SMART
low complexity region 140 177 N/A INTRINSIC
ZnF_C2H2 204 226 1.02e1 SMART
ZnF_C2H2 232 254 9.44e-2 SMART
low complexity region 322 332 N/A INTRINSIC
ZnF_C2H2 336 357 2.12e1 SMART
ZnF_C2H2 363 386 2.45e0 SMART
low complexity region 404 414 N/A INTRINSIC
ZnF_C2H2 418 440 8.94e-3 SMART
ZnF_C2H2 446 468 4.05e-1 SMART
ZnF_C2H2 474 496 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085427
SMART Domains Protein: ENSMUSP00000082550
Gene: ENSMUSG00000074405

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 62 82 N/A INTRINSIC
low complexity region 120 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
ZnF_C2H2 220 242 1.28e-3 SMART
ZnF_C2H2 248 270 5.5e-3 SMART
low complexity region 274 286 N/A INTRINSIC
low complexity region 294 324 N/A INTRINSIC
ZnF_C2H2 350 372 8.81e-2 SMART
ZnF_C2H2 378 400 6.08e-5 SMART
ZnF_C2H2 407 429 1.79e-2 SMART
ZnF_C2H2 439 461 1.92e-2 SMART
low complexity region 478 495 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 523 542 N/A INTRINSIC
ZnF_C2H2 546 568 4.47e-3 SMART
ZnF_C2H2 574 596 5.42e-2 SMART
ZnF_C2H2 602 624 1.72e-4 SMART
low complexity region 628 660 N/A INTRINSIC
ZnF_C2H2 664 686 5.34e-1 SMART
ZnF_C2H2 692 714 2.82e0 SMART
low complexity region 725 745 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000086349
AA Change: D141G

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000083533
Gene: ENSMUSG00000051184
AA Change: D141G

DomainStartEndE-ValueType
AT_hook 29 41 1.53e2 SMART
AT_hook 51 63 1.09e0 SMART
ZnF_C2H2 109 131 1.16e-1 SMART
ZnF_C2H2 137 159 1.56e-2 SMART
ZnF_C2H2 165 187 4.4e-2 SMART
ZnF_C2H2 193 216 7.26e-3 SMART
low complexity region 272 287 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165320
SMART Domains Protein: ENSMUSP00000128105
Gene: ENSMUSG00000061374

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
ZnF_C2H2 29 51 5.99e-4 SMART
ZnF_C2H2 57 79 6.32e-3 SMART
ZnF_C2H2 85 107 1.36e-2 SMART
ZnF_C2H2 113 136 4.72e-2 SMART
low complexity region 140 177 N/A INTRINSIC
ZnF_C2H2 204 226 1.02e1 SMART
ZnF_C2H2 232 254 9.44e-2 SMART
low complexity region 322 332 N/A INTRINSIC
ZnF_C2H2 336 357 2.12e1 SMART
ZnF_C2H2 363 386 2.45e0 SMART
low complexity region 404 414 N/A INTRINSIC
ZnF_C2H2 418 440 8.94e-3 SMART
ZnF_C2H2 446 468 4.05e-1 SMART
ZnF_C2H2 474 496 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167804
SMART Domains Protein: ENSMUSP00000126765
Gene: ENSMUSG00000061374

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
ZnF_C2H2 29 51 5.99e-4 SMART
ZnF_C2H2 57 79 6.32e-3 SMART
ZnF_C2H2 85 107 1.36e-2 SMART
ZnF_C2H2 113 136 4.72e-2 SMART
low complexity region 140 177 N/A INTRINSIC
ZnF_C2H2 204 226 1.02e1 SMART
ZnF_C2H2 232 254 9.44e-2 SMART
low complexity region 322 332 N/A INTRINSIC
ZnF_C2H2 336 357 2.12e1 SMART
ZnF_C2H2 363 386 2.45e0 SMART
low complexity region 404 414 N/A INTRINSIC
ZnF_C2H2 418 440 8.94e-3 SMART
ZnF_C2H2 446 468 4.05e-1 SMART
ZnF_C2H2 474 496 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207030
Predicted Effect possibly damaging
Transcript: ENSMUST00000207050
AA Change: D141G

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000207412
Predicted Effect possibly damaging
Transcript: ENSMUST00000207901
AA Change: D141G

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000207946
Predicted Effect probably benign
Transcript: ENSMUST00000208728
Predicted Effect probably benign
Transcript: ENSMUST00000208944
Predicted Effect possibly damaging
Transcript: ENSMUST00000209030
AA Change: D141G

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000209060
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 A G 8: 55,871,659 C587R probably damaging Het
Adgrg7 T C 16: 56,742,406 T523A probably damaging Het
Arrdc3 A T 13: 80,890,696 K259M probably damaging Het
Becn1 A T 11: 101,295,324 N151K probably benign Het
Cars2 C T 8: 11,529,649 E270K probably damaging Het
Ccp110 C A 7: 118,732,405 P943Q probably damaging Het
Ccser2 A G 14: 36,939,829 I466T probably benign Het
Cd164 A G 10: 41,523,197 E94G probably benign Het
Cdon C T 9: 35,504,150 T1228I probably benign Het
Cubn C A 2: 13,306,280 V3145L probably benign Het
Cubn T A 2: 13,306,281 K3144N probably benign Het
Dchs1 A G 7: 105,761,871 V1649A probably benign Het
Dgka A T 10: 128,733,583 D153E probably damaging Het
Dip2b A G 15: 100,157,972 probably null Het
Dnajc21 T C 15: 10,449,631 T435A probably benign Het
F830016B08Rik A T 18: 60,300,471 I209F probably damaging Het
Ghdc C A 11: 100,769,714 S111I possibly damaging Het
Gm19965 T C 1: 116,821,275 C229R Het
Gpm6a C T 8: 55,037,451 T54I probably damaging Het
Gpr171 G T 3: 59,098,156 A66E probably damaging Het
Grm7 A G 6: 111,358,152 D508G probably benign Het
Has1 G A 17: 17,843,806 R524C probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv3-8 A T 12: 114,322,782 L7Q probably damaging Het
Ints10 A T 8: 68,796,751 R78* probably null Het
Itpr1 A G 6: 108,388,296 I903V probably benign Het
Lrp1 A G 10: 127,550,183 probably null Het
Mki67 A G 7: 135,705,629 V132A probably damaging Het
Myh4 A G 11: 67,253,173 E1123G possibly damaging Het
Neurog3 A G 10: 62,133,580 T40A probably benign Het
Nipsnap3b T A 4: 53,021,095 probably null Het
Nr4a3 G A 4: 48,055,957 V328I probably damaging Het
Olfr1489 G T 19: 13,633,880 M256I possibly damaging Het
Olfr313 G A 11: 58,817,164 R52Q probably benign Het
Olfr487 A T 7: 108,211,998 V177D probably damaging Het
Olfr654 A T 7: 104,588,223 S140C probably damaging Het
Olfr716 T C 7: 107,148,029 F238L probably damaging Het
Olfr743 T A 14: 50,533,821 Y136* probably null Het
Osbpl5 A G 7: 143,709,840 L102P probably benign Het
Ppl C T 16: 5,100,119 R503Q probably damaging Het
Ppp2r2d T C 7: 138,876,597 M321T possibly damaging Het
Prex1 T C 2: 166,633,382 Y197C probably damaging Het
Prss32 A G 17: 23,853,921 D42G possibly damaging Het
Ralgapa1 T C 12: 55,721,576 E1210G possibly damaging Het
Sdr16c5 A G 4: 4,006,591 C234R probably damaging Het
Slc23a4 A G 6: 34,956,884 S95P probably damaging Het
Srp14 T C 2: 118,479,390 T29A probably damaging Het
Tet2 T A 3: 133,467,023 H1826L possibly damaging Het
Tfr2 A T 5: 137,583,574 Y641F probably damaging Het
Tmco5b A G 2: 113,287,421 N27D probably damaging Het
Tvp23a T C 16: 10,428,735 D62G probably benign Het
Usp12 A G 5: 146,737,752 F347S possibly damaging Het
Zfp407 A T 18: 84,558,476 L1504Q probably damaging Het
Zfp68 A G 5: 138,606,939 I374T possibly damaging Het
Zfp758 C T 17: 22,375,156 H208Y probably benign Het
Zfp804b T C 5: 6,769,751 H1104R probably benign Het
Znrf2 T A 6: 54,842,695 *75K probably null Het
Zzef1 T C 11: 72,899,559 V2113A probably benign Het
Other mutations in Zfp524
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02061:Zfp524 APN 7 5017872 missense probably damaging 1.00
IGL02433:Zfp524 APN 7 5018092 missense possibly damaging 0.81
IGL02644:Zfp524 APN 7 5017480 missense probably damaging 0.99
R2211:Zfp524 UTSW 7 5017919 missense probably damaging 1.00
R3755:Zfp524 UTSW 7 5017885 missense probably damaging 1.00
R4579:Zfp524 UTSW 7 5018348 missense probably benign
R5022:Zfp524 UTSW 7 5018417 missense probably benign
R5356:Zfp524 UTSW 7 5018433 missense probably benign
R5580:Zfp524 UTSW 7 5018417 missense probably benign
R7199:Zfp524 UTSW 7 5017884 missense probably damaging 0.98
R7471:Zfp524 UTSW 7 5018201 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGCAGCGATCTTCTGTTGATC -3'
(R):5'- GAGTATTGGCCTCGGTGAAG -3'

Sequencing Primer
(F):5'- ATCGATGATCAGGGTGTTCCTTATAC -3'
(R):5'- GTGAAGCGCACCCTACATGAG -3'
Posted On2019-05-15