Incidental Mutation 'R7076:Olfr716'
ID549217
Institutional Source Beutler Lab
Gene Symbol Olfr716
Ensembl Gene ENSMUSG00000073896
Gene Nameolfactory receptor 716
SynonymsGA_x6K02T2PBJ9-9497411-9498355, MOR260-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7076 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location107138327-107150581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107148029 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 238 (F238L)
Ref Sequence ENSEMBL: ENSMUSP00000150131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098137] [ENSMUST00000209942] [ENSMUST00000210474] [ENSMUST00000213367] [ENSMUST00000214819] [ENSMUST00000215284] [ENSMUST00000216871]
Predicted Effect probably damaging
Transcript: ENSMUST00000098137
AA Change: F238L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095740
Gene: ENSMUSG00000073896
AA Change: F238L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.4e-57 PFAM
Pfam:7tm_1 41 290 3.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209942
Predicted Effect probably benign
Transcript: ENSMUST00000210474
Predicted Effect probably damaging
Transcript: ENSMUST00000213367
AA Change: F238L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214819
AA Change: F238L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215284
AA Change: F238L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216871
AA Change: F238L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1291 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 A G 8: 55,871,659 C587R probably damaging Het
Adgrg7 T C 16: 56,742,406 T523A probably damaging Het
Arrdc3 A T 13: 80,890,696 K259M probably damaging Het
Becn1 A T 11: 101,295,324 N151K probably benign Het
Cars2 C T 8: 11,529,649 E270K probably damaging Het
Ccp110 C A 7: 118,732,405 P943Q probably damaging Het
Ccser2 A G 14: 36,939,829 I466T probably benign Het
Cd164 A G 10: 41,523,197 E94G probably benign Het
Cdon C T 9: 35,504,150 T1228I probably benign Het
Cubn C A 2: 13,306,280 V3145L probably benign Het
Cubn T A 2: 13,306,281 K3144N probably benign Het
Dchs1 A G 7: 105,761,871 V1649A probably benign Het
Dgka A T 10: 128,733,583 D153E probably damaging Het
Dip2b A G 15: 100,157,972 probably null Het
Dnajc21 T C 15: 10,449,631 T435A probably benign Het
F830016B08Rik A T 18: 60,300,471 I209F probably damaging Het
Ghdc C A 11: 100,769,714 S111I possibly damaging Het
Gm19965 T C 1: 116,821,275 C229R Het
Gpm6a C T 8: 55,037,451 T54I probably damaging Het
Gpr171 G T 3: 59,098,156 A66E probably damaging Het
Grm7 A G 6: 111,358,152 D508G probably benign Het
Has1 G A 17: 17,843,806 R524C probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv3-8 A T 12: 114,322,782 L7Q probably damaging Het
Ints10 A T 8: 68,796,751 R78* probably null Het
Itpr1 A G 6: 108,388,296 I903V probably benign Het
Lrp1 A G 10: 127,550,183 probably null Het
Mki67 A G 7: 135,705,629 V132A probably damaging Het
Myh4 A G 11: 67,253,173 E1123G possibly damaging Het
Neurog3 A G 10: 62,133,580 T40A probably benign Het
Nipsnap3b T A 4: 53,021,095 probably null Het
Nr4a3 G A 4: 48,055,957 V328I probably damaging Het
Olfr1489 G T 19: 13,633,880 M256I possibly damaging Het
Olfr313 G A 11: 58,817,164 R52Q probably benign Het
Olfr487 A T 7: 108,211,998 V177D probably damaging Het
Olfr654 A T 7: 104,588,223 S140C probably damaging Het
Olfr743 T A 14: 50,533,821 Y136* probably null Het
Osbpl5 A G 7: 143,709,840 L102P probably benign Het
Ppl C T 16: 5,100,119 R503Q probably damaging Het
Ppp2r2d T C 7: 138,876,597 M321T possibly damaging Het
Prex1 T C 2: 166,633,382 Y197C probably damaging Het
Prss32 A G 17: 23,853,921 D42G possibly damaging Het
Ralgapa1 T C 12: 55,721,576 E1210G possibly damaging Het
Sdr16c5 A G 4: 4,006,591 C234R probably damaging Het
Slc23a4 A G 6: 34,956,884 S95P probably damaging Het
Srp14 T C 2: 118,479,390 T29A probably damaging Het
Tet2 T A 3: 133,467,023 H1826L possibly damaging Het
Tfr2 A T 5: 137,583,574 Y641F probably damaging Het
Tmco5b A G 2: 113,287,421 N27D probably damaging Het
Tvp23a T C 16: 10,428,735 D62G probably benign Het
Usp12 A G 5: 146,737,752 F347S possibly damaging Het
Zfp407 A T 18: 84,558,476 L1504Q probably damaging Het
Zfp524 A G 7: 5,017,896 D141G possibly damaging Het
Zfp68 A G 5: 138,606,939 I374T possibly damaging Het
Zfp758 C T 17: 22,375,156 H208Y probably benign Het
Zfp804b T C 5: 6,769,751 H1104R probably benign Het
Znrf2 T A 6: 54,842,695 *75K probably null Het
Zzef1 T C 11: 72,899,559 V2113A probably benign Het
Other mutations in Olfr716
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01781:Olfr716 APN 7 107147696 missense probably damaging 1.00
IGL02792:Olfr716 APN 7 107148218 missense probably benign 0.00
IGL03300:Olfr716 APN 7 107147409 missense probably damaging 1.00
R0071:Olfr716 UTSW 7 107147712 missense probably damaging 1.00
R0071:Olfr716 UTSW 7 107147712 missense probably damaging 1.00
R0391:Olfr716 UTSW 7 107148187 nonsense probably null
R0962:Olfr716 UTSW 7 107148087 missense possibly damaging 0.94
R1440:Olfr716 UTSW 7 107148198 missense probably damaging 1.00
R5561:Olfr716 UTSW 7 107148090 missense probably benign 0.05
R5700:Olfr716 UTSW 7 107147541 missense probably benign
R5997:Olfr716 UTSW 7 107147328 missense possibly damaging 0.79
R6262:Olfr716 UTSW 7 107147711 missense probably damaging 1.00
R6922:Olfr716 UTSW 7 107148083 missense probably damaging 0.98
R8025:Olfr716 UTSW 7 107147723 missense possibly damaging 0.87
Z1088:Olfr716 UTSW 7 107148212 missense probably benign
Z1176:Olfr716 UTSW 7 107148155 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GCAGAACATAGTCAGCCATTAC -3'
(R):5'- GCAGCTAGTTTCCTGAAGGC -3'

Sequencing Primer
(F):5'- AGTCAGCCATTACTTTTGTGAAC -3'
(R):5'- TTGACATCCTTGTTCCGAAGAC -3'
Posted On2019-05-15