Incidental Mutation 'R7076:Ppp2r2d'
ID549221
Institutional Source Beutler Lab
Gene Symbol Ppp2r2d
Ensembl Gene ENSMUSG00000041769
Gene Nameprotein phosphatase 2, regulatory subunit B, delta
Synonyms1300017E19Rik, MDS026, D7Ertd753e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R7076 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location138846079-138883057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138876597 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 321 (M321T)
Ref Sequence ENSEMBL: ENSMUSP00000040321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041097] [ENSMUST00000136824] [ENSMUST00000155672]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041097
AA Change: M321T

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040321
Gene: ENSMUSG00000041769
AA Change: M321T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
WD40 27 62 1.91e1 SMART
WD40 89 129 4.77e0 SMART
WD40 171 210 1.19e0 SMART
WD40 221 261 1.91e1 SMART
WD40 280 318 4.11e1 SMART
WD40 345 376 2.54e2 SMART
WD40 412 449 3.82e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136824
SMART Domains Protein: ENSMUSP00000133380
Gene: ENSMUSG00000041769

DomainStartEndE-ValueType
PDB:3DW8|E 6 69 3e-31 PDB
Blast:WD40 15 57 3e-22 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000155672
AA Change: M156T

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119004
Gene: ENSMUSG00000041769
AA Change: M156T

DomainStartEndE-ValueType
WD40 6 45 1.19e0 SMART
WD40 56 96 1.91e1 SMART
WD40 115 153 4.11e1 SMART
WD40 180 211 2.54e2 SMART
WD40 247 284 3.82e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172764
SMART Domains Protein: ENSMUSP00000133810
Gene: ENSMUSG00000041769

DomainStartEndE-ValueType
SCOP:d1k32a3 2 103 9e-8 SMART
PDB:3DW8|E 2 127 2e-75 PDB
Blast:WD40 56 96 4e-22 BLAST
Meta Mutation Damage Score 0.4770 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 A G 8: 55,871,659 C587R probably damaging Het
Adgrg7 T C 16: 56,742,406 T523A probably damaging Het
Arrdc3 A T 13: 80,890,696 K259M probably damaging Het
Becn1 A T 11: 101,295,324 N151K probably benign Het
Cars2 C T 8: 11,529,649 E270K probably damaging Het
Ccp110 C A 7: 118,732,405 P943Q probably damaging Het
Ccser2 A G 14: 36,939,829 I466T probably benign Het
Cd164 A G 10: 41,523,197 E94G probably benign Het
Cdon C T 9: 35,504,150 T1228I probably benign Het
Cubn C A 2: 13,306,280 V3145L probably benign Het
Cubn T A 2: 13,306,281 K3144N probably benign Het
Dchs1 A G 7: 105,761,871 V1649A probably benign Het
Dgka A T 10: 128,733,583 D153E probably damaging Het
Dip2b A G 15: 100,157,972 probably null Het
Dnajc21 T C 15: 10,449,631 T435A probably benign Het
F830016B08Rik A T 18: 60,300,471 I209F probably damaging Het
Ghdc C A 11: 100,769,714 S111I possibly damaging Het
Gm19965 T C 1: 116,821,275 C229R Het
Gpm6a C T 8: 55,037,451 T54I probably damaging Het
Gpr171 G T 3: 59,098,156 A66E probably damaging Het
Grm7 A G 6: 111,358,152 D508G probably benign Het
Has1 G A 17: 17,843,806 R524C probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv3-8 A T 12: 114,322,782 L7Q probably damaging Het
Ints10 A T 8: 68,796,751 R78* probably null Het
Itpr1 A G 6: 108,388,296 I903V probably benign Het
Lrp1 A G 10: 127,550,183 probably null Het
Mki67 A G 7: 135,705,629 V132A probably damaging Het
Myh4 A G 11: 67,253,173 E1123G possibly damaging Het
Neurog3 A G 10: 62,133,580 T40A probably benign Het
Nipsnap3b T A 4: 53,021,095 probably null Het
Nr4a3 G A 4: 48,055,957 V328I probably damaging Het
Olfr1489 G T 19: 13,633,880 M256I possibly damaging Het
Olfr313 G A 11: 58,817,164 R52Q probably benign Het
Olfr487 A T 7: 108,211,998 V177D probably damaging Het
Olfr654 A T 7: 104,588,223 S140C probably damaging Het
Olfr716 T C 7: 107,148,029 F238L probably damaging Het
Olfr743 T A 14: 50,533,821 Y136* probably null Het
Osbpl5 A G 7: 143,709,840 L102P probably benign Het
Ppl C T 16: 5,100,119 R503Q probably damaging Het
Prex1 T C 2: 166,633,382 Y197C probably damaging Het
Prss32 A G 17: 23,853,921 D42G possibly damaging Het
Ralgapa1 T C 12: 55,721,576 E1210G possibly damaging Het
Sdr16c5 A G 4: 4,006,591 C234R probably damaging Het
Slc23a4 A G 6: 34,956,884 S95P probably damaging Het
Srp14 T C 2: 118,479,390 T29A probably damaging Het
Tet2 T A 3: 133,467,023 H1826L possibly damaging Het
Tfr2 A T 5: 137,583,574 Y641F probably damaging Het
Tmco5b A G 2: 113,287,421 N27D probably damaging Het
Tvp23a T C 16: 10,428,735 D62G probably benign Het
Usp12 A G 5: 146,737,752 F347S possibly damaging Het
Zfp407 A T 18: 84,558,476 L1504Q probably damaging Het
Zfp524 A G 7: 5,017,896 D141G possibly damaging Het
Zfp68 A G 5: 138,606,939 I374T possibly damaging Het
Zfp758 C T 17: 22,375,156 H208Y probably benign Het
Zfp804b T C 5: 6,769,751 H1104R probably benign Het
Znrf2 T A 6: 54,842,695 *75K probably null Het
Zzef1 T C 11: 72,899,559 V2113A probably benign Het
Other mutations in Ppp2r2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Ppp2r2d APN 7 138882211 missense probably benign
IGL01538:Ppp2r2d APN 7 138876635 missense probably damaging 1.00
IGL02266:Ppp2r2d APN 7 138868437 missense probably damaging 0.97
IGL02268:Ppp2r2d APN 7 138872971 missense probably null 1.00
IGL03263:Ppp2r2d APN 7 138872922 nonsense probably null
R0482:Ppp2r2d UTSW 7 138870431 missense probably benign 0.08
R1946:Ppp2r2d UTSW 7 138868467 missense probably damaging 1.00
R4043:Ppp2r2d UTSW 7 138882416 nonsense probably null
R4326:Ppp2r2d UTSW 7 138868485 missense probably damaging 1.00
R6164:Ppp2r2d UTSW 7 138873013 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTGACTCTAGGATGGTAGTCTTCTG -3'
(R):5'- ATGAACCAGCACTTTCGGGTG -3'

Sequencing Primer
(F):5'- AGTCTTCTGATTTAGCAGGGTAAC -3'
(R):5'- TGCCGGCGTGCTAGGAC -3'
Posted On2019-05-15