Incidental Mutation 'R7076:Cars2'
ID549223
Institutional Source Beutler Lab
Gene Symbol Cars2
Ensembl Gene ENSMUSG00000056228
Gene Namecysteinyl-tRNA synthetase 2 (mitochondrial)(putative)
SynonymsD530030H10Rik, 2310051N18Rik, 2410044A07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R7076 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location11513977-11550783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 11529649 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 270 (E270K)
Ref Sequence ENSEMBL: ENSMUSP00000046453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049461] [ENSMUST00000210478] [ENSMUST00000210599]
Predicted Effect probably damaging
Transcript: ENSMUST00000049461
AA Change: E270K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046453
Gene: ENSMUSG00000056228
AA Change: E270K

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:tRNA-synt_1e 50 351 4.1e-116 PFAM
Pfam:tRNA-synt_1g 63 207 1.5e-7 PFAM
Pfam:tRNA-synt_1g 280 370 4.2e-7 PFAM
Blast:DALR_2 391 461 3e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000210478
Predicted Effect probably benign
Transcript: ENSMUST00000210599
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative member of the class I family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of cysteine to tRNA molecules. A splice-site mutation in this gene has been associated with a novel progressive myoclonic epilepsy disease with similar symptoms to MERRF syndrome. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for an ENU-induced allele develop induced hyperactivity followed by head bobbing and tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 A G 8: 55,871,659 C587R probably damaging Het
Adgrg7 T C 16: 56,742,406 T523A probably damaging Het
Arrdc3 A T 13: 80,890,696 K259M probably damaging Het
Becn1 A T 11: 101,295,324 N151K probably benign Het
Ccp110 C A 7: 118,732,405 P943Q probably damaging Het
Ccser2 A G 14: 36,939,829 I466T probably benign Het
Cd164 A G 10: 41,523,197 E94G probably benign Het
Cdon C T 9: 35,504,150 T1228I probably benign Het
Cubn C A 2: 13,306,280 V3145L probably benign Het
Cubn T A 2: 13,306,281 K3144N probably benign Het
Dchs1 A G 7: 105,761,871 V1649A probably benign Het
Dgka A T 10: 128,733,583 D153E probably damaging Het
Dip2b A G 15: 100,157,972 probably null Het
Dnajc21 T C 15: 10,449,631 T435A probably benign Het
F830016B08Rik A T 18: 60,300,471 I209F probably damaging Het
Ghdc C A 11: 100,769,714 S111I possibly damaging Het
Gm19965 T C 1: 116,821,275 C229R Het
Gpm6a C T 8: 55,037,451 T54I probably damaging Het
Gpr171 G T 3: 59,098,156 A66E probably damaging Het
Grm7 A G 6: 111,358,152 D508G probably benign Het
Has1 G A 17: 17,843,806 R524C probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv3-8 A T 12: 114,322,782 L7Q probably damaging Het
Ints10 A T 8: 68,796,751 R78* probably null Het
Itpr1 A G 6: 108,388,296 I903V probably benign Het
Lrp1 A G 10: 127,550,183 probably null Het
Mki67 A G 7: 135,705,629 V132A probably damaging Het
Myh4 A G 11: 67,253,173 E1123G possibly damaging Het
Neurog3 A G 10: 62,133,580 T40A probably benign Het
Nipsnap3b T A 4: 53,021,095 probably null Het
Nr4a3 G A 4: 48,055,957 V328I probably damaging Het
Olfr1489 G T 19: 13,633,880 M256I possibly damaging Het
Olfr313 G A 11: 58,817,164 R52Q probably benign Het
Olfr487 A T 7: 108,211,998 V177D probably damaging Het
Olfr654 A T 7: 104,588,223 S140C probably damaging Het
Olfr716 T C 7: 107,148,029 F238L probably damaging Het
Olfr743 T A 14: 50,533,821 Y136* probably null Het
Osbpl5 A G 7: 143,709,840 L102P probably benign Het
Ppl C T 16: 5,100,119 R503Q probably damaging Het
Ppp2r2d T C 7: 138,876,597 M321T possibly damaging Het
Prex1 T C 2: 166,633,382 Y197C probably damaging Het
Prss32 A G 17: 23,853,921 D42G possibly damaging Het
Ralgapa1 T C 12: 55,721,576 E1210G possibly damaging Het
Sdr16c5 A G 4: 4,006,591 C234R probably damaging Het
Slc23a4 A G 6: 34,956,884 S95P probably damaging Het
Srp14 T C 2: 118,479,390 T29A probably damaging Het
Tet2 T A 3: 133,467,023 H1826L possibly damaging Het
Tfr2 A T 5: 137,583,574 Y641F probably damaging Het
Tmco5b A G 2: 113,287,421 N27D probably damaging Het
Tvp23a T C 16: 10,428,735 D62G probably benign Het
Usp12 A G 5: 146,737,752 F347S possibly damaging Het
Zfp407 A T 18: 84,558,476 L1504Q probably damaging Het
Zfp524 A G 7: 5,017,896 D141G possibly damaging Het
Zfp68 A G 5: 138,606,939 I374T possibly damaging Het
Zfp758 C T 17: 22,375,156 H208Y probably benign Het
Zfp804b T C 5: 6,769,751 H1104R probably benign Het
Znrf2 T A 6: 54,842,695 *75K probably null Het
Zzef1 T C 11: 72,899,559 V2113A probably benign Het
Other mutations in Cars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
madcow UTSW 8 11526034 missense probably damaging 1.00
PIT4810001:Cars2 UTSW 8 11514699 missense probably benign
R0633:Cars2 UTSW 8 11550511 missense probably benign 0.00
R0788:Cars2 UTSW 8 11529672 missense possibly damaging 0.76
R1493:Cars2 UTSW 8 11517817 critical splice donor site probably null
R1559:Cars2 UTSW 8 11530430 splice site probably null
R1846:Cars2 UTSW 8 11514674 missense probably benign 0.03
R1954:Cars2 UTSW 8 11550286 missense probably damaging 1.00
R1955:Cars2 UTSW 8 11550286 missense probably damaging 1.00
R1993:Cars2 UTSW 8 11514515 missense probably benign 0.03
R2062:Cars2 UTSW 8 11547747 missense probably damaging 1.00
R2153:Cars2 UTSW 8 11530299 missense possibly damaging 0.87
R5004:Cars2 UTSW 8 11518956 splice site probably null
R5320:Cars2 UTSW 8 11517854 missense probably benign 0.09
R6004:Cars2 UTSW 8 11547743 missense probably damaging 1.00
R6089:Cars2 UTSW 8 11530301 missense probably damaging 0.98
R6265:Cars2 UTSW 8 11529599 frame shift probably null
R6267:Cars2 UTSW 8 11529599 frame shift probably null
R6268:Cars2 UTSW 8 11529599 frame shift probably null
R6841:Cars2 UTSW 8 11516198 missense probably benign 0.01
R7586:Cars2 UTSW 8 11530321 nonsense probably null
R8342:Cars2 UTSW 8 11529706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTCAGTCAAACTCATCTCCCAG -3'
(R):5'- AGCTTCAGCAGTTGGTTCCTG -3'

Sequencing Primer
(F):5'- AGCCCTGCCAGCAGATCTATG -3'
(R):5'- TGCCAGCCCGGTAGATC -3'
Posted On2019-05-15