Incidental Mutation 'R7076:Ints10'
ID549226
Institutional Source Beutler Lab
Gene Symbol Ints10
Ensembl Gene ENSMUSG00000031864
Gene Nameintegrator complex subunit 10
Synonyms4921521J11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7076 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location68793929-68831667 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 68796751 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 78 (R78*)
Ref Sequence ENSEMBL: ENSMUSP00000069908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034328] [ENSMUST00000070713] [ENSMUST00000110241] [ENSMUST00000110242]
Predicted Effect probably null
Transcript: ENSMUST00000034328
AA Change: R78*
SMART Domains Protein: ENSMUSP00000034328
Gene: ENSMUSG00000031864
AA Change: R78*

DomainStartEndE-ValueType
low complexity region 132 138 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000070713
AA Change: R78*
SMART Domains Protein: ENSMUSP00000069908
Gene: ENSMUSG00000031864
AA Change: R78*

DomainStartEndE-ValueType
low complexity region 132 138 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110241
AA Change: R78*
SMART Domains Protein: ENSMUSP00000105870
Gene: ENSMUSG00000031864
AA Change: R78*

DomainStartEndE-ValueType
low complexity region 132 138 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110242
AA Change: R78*
SMART Domains Protein: ENSMUSP00000105871
Gene: ENSMUSG00000031864
AA Change: R78*

DomainStartEndE-ValueType
low complexity region 132 138 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS10 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 A G 8: 55,871,659 C587R probably damaging Het
Adgrg7 T C 16: 56,742,406 T523A probably damaging Het
Arrdc3 A T 13: 80,890,696 K259M probably damaging Het
Becn1 A T 11: 101,295,324 N151K probably benign Het
Cars2 C T 8: 11,529,649 E270K probably damaging Het
Ccp110 C A 7: 118,732,405 P943Q probably damaging Het
Ccser2 A G 14: 36,939,829 I466T probably benign Het
Cd164 A G 10: 41,523,197 E94G probably benign Het
Cdon C T 9: 35,504,150 T1228I probably benign Het
Cubn C A 2: 13,306,280 V3145L probably benign Het
Cubn T A 2: 13,306,281 K3144N probably benign Het
Dchs1 A G 7: 105,761,871 V1649A probably benign Het
Dgka A T 10: 128,733,583 D153E probably damaging Het
Dip2b A G 15: 100,157,972 probably null Het
Dnajc21 T C 15: 10,449,631 T435A probably benign Het
F830016B08Rik A T 18: 60,300,471 I209F probably damaging Het
Ghdc C A 11: 100,769,714 S111I possibly damaging Het
Gm19965 T C 1: 116,821,275 C229R Het
Gpm6a C T 8: 55,037,451 T54I probably damaging Het
Gpr171 G T 3: 59,098,156 A66E probably damaging Het
Grm7 A G 6: 111,358,152 D508G probably benign Het
Has1 G A 17: 17,843,806 R524C probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv3-8 A T 12: 114,322,782 L7Q probably damaging Het
Itpr1 A G 6: 108,388,296 I903V probably benign Het
Lrp1 A G 10: 127,550,183 probably null Het
Mki67 A G 7: 135,705,629 V132A probably damaging Het
Myh4 A G 11: 67,253,173 E1123G possibly damaging Het
Neurog3 A G 10: 62,133,580 T40A probably benign Het
Nipsnap3b T A 4: 53,021,095 probably null Het
Nr4a3 G A 4: 48,055,957 V328I probably damaging Het
Olfr1489 G T 19: 13,633,880 M256I possibly damaging Het
Olfr313 G A 11: 58,817,164 R52Q probably benign Het
Olfr487 A T 7: 108,211,998 V177D probably damaging Het
Olfr654 A T 7: 104,588,223 S140C probably damaging Het
Olfr716 T C 7: 107,148,029 F238L probably damaging Het
Olfr743 T A 14: 50,533,821 Y136* probably null Het
Osbpl5 A G 7: 143,709,840 L102P probably benign Het
Ppl C T 16: 5,100,119 R503Q probably damaging Het
Ppp2r2d T C 7: 138,876,597 M321T possibly damaging Het
Prex1 T C 2: 166,633,382 Y197C probably damaging Het
Prss32 A G 17: 23,853,921 D42G possibly damaging Het
Ralgapa1 T C 12: 55,721,576 E1210G possibly damaging Het
Sdr16c5 A G 4: 4,006,591 C234R probably damaging Het
Slc23a4 A G 6: 34,956,884 S95P probably damaging Het
Srp14 T C 2: 118,479,390 T29A probably damaging Het
Tet2 T A 3: 133,467,023 H1826L possibly damaging Het
Tfr2 A T 5: 137,583,574 Y641F probably damaging Het
Tmco5b A G 2: 113,287,421 N27D probably damaging Het
Tvp23a T C 16: 10,428,735 D62G probably benign Het
Usp12 A G 5: 146,737,752 F347S possibly damaging Het
Zfp407 A T 18: 84,558,476 L1504Q probably damaging Het
Zfp524 A G 7: 5,017,896 D141G possibly damaging Het
Zfp68 A G 5: 138,606,939 I374T possibly damaging Het
Zfp758 C T 17: 22,375,156 H208Y probably benign Het
Zfp804b T C 5: 6,769,751 H1104R probably benign Het
Znrf2 T A 6: 54,842,695 *75K probably null Het
Zzef1 T C 11: 72,899,559 V2113A probably benign Het
Other mutations in Ints10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Ints10 APN 8 68819333 missense probably damaging 1.00
IGL00964:Ints10 APN 8 68811986 missense probably damaging 1.00
IGL02326:Ints10 APN 8 68804833 missense probably damaging 0.99
R0012:Ints10 UTSW 8 68807475 missense probably benign 0.01
R0112:Ints10 UTSW 8 68827302 missense probably damaging 0.99
R1302:Ints10 UTSW 8 68827312 missense probably damaging 1.00
R1462:Ints10 UTSW 8 68807644 splice site probably benign
R1540:Ints10 UTSW 8 68796713 splice site probably benign
R1592:Ints10 UTSW 8 68802903 missense possibly damaging 0.69
R1845:Ints10 UTSW 8 68794671 missense probably damaging 1.00
R2144:Ints10 UTSW 8 68796805 missense probably damaging 1.00
R2323:Ints10 UTSW 8 68819345 missense probably benign 0.09
R3765:Ints10 UTSW 8 68825119 missense possibly damaging 0.78
R3910:Ints10 UTSW 8 68813620 missense probably damaging 0.96
R3912:Ints10 UTSW 8 68813620 missense probably damaging 0.96
R3913:Ints10 UTSW 8 68813620 missense probably damaging 0.96
R4050:Ints10 UTSW 8 68827351 missense probably damaging 1.00
R4151:Ints10 UTSW 8 68794598 splice site probably null
R4607:Ints10 UTSW 8 68810619 missense probably damaging 1.00
R4608:Ints10 UTSW 8 68810619 missense probably damaging 1.00
R4881:Ints10 UTSW 8 68810604 missense probably benign 0.08
R4911:Ints10 UTSW 8 68827312 missense probably damaging 0.98
R5255:Ints10 UTSW 8 68793972 start gained probably benign
R5331:Ints10 UTSW 8 68820820 splice site probably null
R5461:Ints10 UTSW 8 68794041 missense possibly damaging 0.59
R5740:Ints10 UTSW 8 68804922 missense probably damaging 0.96
R5741:Ints10 UTSW 8 68804922 missense probably damaging 0.96
R6128:Ints10 UTSW 8 68822252 critical splice donor site probably null
R6465:Ints10 UTSW 8 68807536 missense probably benign
R6868:Ints10 UTSW 8 68797798 missense probably damaging 1.00
R6983:Ints10 UTSW 8 68794051 missense probably damaging 1.00
R7216:Ints10 UTSW 8 68822157 missense probably damaging 0.96
R7652:Ints10 UTSW 8 68825119 missense possibly damaging 0.78
R8134:Ints10 UTSW 8 68802986 nonsense probably null
R8176:Ints10 UTSW 8 68802951 missense probably damaging 1.00
R8185:Ints10 UTSW 8 68796718 missense possibly damaging 0.51
X0027:Ints10 UTSW 8 68808474 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTGTGGGTTCAGATTTATTAAAGT -3'
(R):5'- TCACTGTGGACTTTCATTGCC -3'

Sequencing Primer
(F):5'- AGGATGACCTTGAACCTCTGATC -3'
(R):5'- GGACTTTCATTGCCTAGAATAAAAAG -3'
Posted On2019-05-15