Mutagenetix > Incidental Mutations

Incidental Mutation 'R7076:Cdon'

549227

Institutional Source

Beutler Lab

Gene Symbol

Cdon

Ensembl Gene

ENSMUSG00000038119

Gene Name

cell adhesion molecule-related/down-regulated by oncogenes

Synonyms

CDO, CAM-related/down-regulated by oncogenes

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.479) question?

Stock #

R7076 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

35421128-35507652 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 35504150 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1228 (T1228I)

Ref Sequence

ENSEMBL: ENSMUSP00000045547 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042842] [ENSMUST00000119129]

Predicted Effect

probably benign
Transcript: ENSMUST00000042842
AA Change: T1228I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000045547
Gene: ENSMUSG00000038119
AA Change: T1228I

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGc2	40	103	1.35e-9	SMART
IG	125	212	7.25e-1	SMART
IGc2	233	296	1.38e-6	SMART
IGc2	323	386	4.62e-17	SMART
IGc2	416	506	5e-13	SMART
FN3	573	660	2.18e-2	SMART
FN3	717	800	1.89e-11	SMART
FN3	822	909	7.01e-6	SMART
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1101	1111	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119129
AA Change: T1228I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000113977
Gene: ENSMUSG00000038119
AA Change: T1228I

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGc2	40	103	1.35e-9	SMART
IG	125	212	7.25e-1	SMART
IGc2	233	296	1.38e-6	SMART
IGc2	323	386	4.62e-17	SMART
IGc2	416	506	5e-13	SMART
FN3	573	660	2.18e-2	SMART
FN3	717	800	1.89e-11	SMART
FN3	822	909	7.01e-6	SMART
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1101	1111	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor that is a member of the immunoglobulin superfamily. The encoded protein contains three fibronectin type III domains and five immunoglobulin-like C2-type domains. This protein is a member of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells and positively regulates myogenesis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice display facial defects characteristic of microform holoprosencephaly, are runted, and are prone to death prior to weaning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam29	A	G	8: 55,871,659	C587R	probably damaging	Het
Adgrg7	T	C	16: 56,742,406	T523A	probably damaging	Het
Arrdc3	A	T	13: 80,890,696	K259M	probably damaging	Het
Becn1	A	T	11: 101,295,324	N151K	probably benign	Het
Cars2	C	T	8: 11,529,649	E270K	probably damaging	Het
Ccp110	C	A	7: 118,732,405	P943Q	probably damaging	Het
Ccser2	A	G	14: 36,939,829	I466T	probably benign	Het
Cd164	A	G	10: 41,523,197	E94G	probably benign	Het
Cubn	C	A	2: 13,306,280	V3145L	probably benign	Het
Cubn	T	A	2: 13,306,281	K3144N	probably benign	Het
Dchs1	A	G	7: 105,761,871	V1649A	probably benign	Het
Dgka	A	T	10: 128,733,583	D153E	probably damaging	Het
Dip2b	A	G	15: 100,157,972		probably null	Het
Dnajc21	T	C	15: 10,449,631	T435A	probably benign	Het
F830016B08Rik	A	T	18: 60,300,471	I209F	probably damaging	Het
Ghdc	C	A	11: 100,769,714	S111I	possibly damaging	Het
Gm19965	T	C	1: 116,821,275	C229R		Het
Gpm6a	C	T	8: 55,037,451	T54I	probably damaging	Het
Gpr171	G	T	3: 59,098,156	A66E	probably damaging	Het
Grm7	A	G	6: 111,358,152	D508G	probably benign	Het
Has1	G	A	17: 17,843,806	R524C	probably damaging	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Ighv3-8	A	T	12: 114,322,782	L7Q	probably damaging	Het
Ints10	A	T	8: 68,796,751	R78*	probably null	Het
Itpr1	A	G	6: 108,388,296	I903V	probably benign	Het
Lrp1	A	G	10: 127,550,183		probably null	Het
Mki67	A	G	7: 135,705,629	V132A	probably damaging	Het
Myh4	A	G	11: 67,253,173	E1123G	possibly damaging	Het
Neurog3	A	G	10: 62,133,580	T40A	probably benign	Het
Nipsnap3b	T	A	4: 53,021,095		probably null	Het
Nr4a3	G	A	4: 48,055,957	V328I	probably damaging	Het
Olfr1489	G	T	19: 13,633,880	M256I	possibly damaging	Het
Olfr313	G	A	11: 58,817,164	R52Q	probably benign	Het
Olfr487	A	T	7: 108,211,998	V177D	probably damaging	Het
Olfr654	A	T	7: 104,588,223	S140C	probably damaging	Het
Olfr716	T	C	7: 107,148,029	F238L	probably damaging	Het
Olfr743	T	A	14: 50,533,821	Y136*	probably null	Het
Osbpl5	A	G	7: 143,709,840	L102P	probably benign	Het
Ppl	C	T	16: 5,100,119	R503Q	probably damaging	Het
Ppp2r2d	T	C	7: 138,876,597	M321T	possibly damaging	Het
Prex1	T	C	2: 166,633,382	Y197C	probably damaging	Het
Prss32	A	G	17: 23,853,921	D42G	possibly damaging	Het
Ralgapa1	T	C	12: 55,721,576	E1210G	possibly damaging	Het
Sdr16c5	A	G	4: 4,006,591	C234R	probably damaging	Het
Slc23a4	A	G	6: 34,956,884	S95P	probably damaging	Het
Srp14	T	C	2: 118,479,390	T29A	probably damaging	Het
Tet2	T	A	3: 133,467,023	H1826L	possibly damaging	Het
Tfr2	A	T	5: 137,583,574	Y641F	probably damaging	Het
Tmco5b	A	G	2: 113,287,421	N27D	probably damaging	Het
Tvp23a	T	C	16: 10,428,735	D62G	probably benign	Het
Usp12	A	G	5: 146,737,752	F347S	possibly damaging	Het
Zfp407	A	T	18: 84,558,476	L1504Q	probably damaging	Het
Zfp524	A	G	7: 5,017,896	D141G	possibly damaging	Het
Zfp68	A	G	5: 138,606,939	I374T	possibly damaging	Het
Zfp758	C	T	17: 22,375,156	H208Y	probably benign	Het
Zfp804b	T	C	5: 6,769,751	H1104R	probably benign	Het
Znrf2	T	A	6: 54,842,695	*75K	probably null	Het
Zzef1	T	C	11: 72,899,559	V2113A	probably benign	Het

Other mutations in Cdon

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00832:Cdon	APN	9	35478116	missense	probably damaging	1.00
IGL01307:Cdon	APN	9	35457564	missense	probably benign	0.01
IGL01528:Cdon	APN	9	35470107	missense	possibly damaging	0.95
IGL01663:Cdon	APN	9	35483214	missense	possibly damaging	0.57
IGL01723:Cdon	APN	9	35503338	missense	probably benign	0.05
IGL02200:Cdon	APN	9	35483109	missense	probably benign	0.28
IGL02444:Cdon	APN	9	35473448	missense	probably benign	0.09
IGL02547:Cdon	APN	9	35478654	missense	probably damaging	1.00
IGL02620:Cdon	APN	9	35452799	missense	probably benign	0.00
IGL02861:Cdon	APN	9	35486957	missense	probably damaging	0.96
IGL02894:Cdon	APN	9	35455426	missense	probably benign	0.01
IGL03153:Cdon	APN	9	35477959	missense	probably damaging	1.00
IGL03206:Cdon	APN	9	35503306	missense	probably benign
IGL03374:Cdon	APN	9	35478003	missense	possibly damaging	0.46
indentured	UTSW	9	35452106	start codon destroyed	probably null	1.00
Molar	UTSW	9	35463895	missense	probably benign	0.15
PIT4280001:Cdon	UTSW	9	35486935	missense	probably damaging	1.00
R0045:Cdon	UTSW	9	35486807	missense	probably benign
R0045:Cdon	UTSW	9	35486807	missense	probably benign
R0064:Cdon	UTSW	9	35489227	missense	probably benign	0.03
R0396:Cdon	UTSW	9	35470130	missense	probably damaging	1.00
R0403:Cdon	UTSW	9	35473500	missense	probably benign	0.00
R0490:Cdon	UTSW	9	35452682	missense	probably damaging	1.00
R0547:Cdon	UTSW	9	35457498	missense	possibly damaging	0.88
R0609:Cdon	UTSW	9	35478611	missense	probably damaging	1.00
R0645:Cdon	UTSW	9	35477083	splice site	probably null
R0781:Cdon	UTSW	9	35456437	splice site	probably benign
R1110:Cdon	UTSW	9	35456437	splice site	probably benign
R1391:Cdon	UTSW	9	35504189	missense	possibly damaging	0.51
R1574:Cdon	UTSW	9	35452937	splice site	probably benign
R1851:Cdon	UTSW	9	35483158	missense	probably damaging	1.00
R2031:Cdon	UTSW	9	35504074	missense	probably damaging	0.96
R2230:Cdon	UTSW	9	35491926	critical splice donor site	probably null
R3683:Cdon	UTSW	9	35489032	missense	possibly damaging	0.89
R3684:Cdon	UTSW	9	35489032	missense	possibly damaging	0.89
R3685:Cdon	UTSW	9	35489032	missense	possibly damaging	0.89
R3941:Cdon	UTSW	9	35464171	missense	probably benign	0.09
R4030:Cdon	UTSW	9	35491906	missense	probably damaging	1.00
R4084:Cdon	UTSW	9	35478131	missense	probably damaging	0.98
R4462:Cdon	UTSW	9	35457580	missense	probably damaging	0.97
R4569:Cdon	UTSW	9	35476969	missense	probably damaging	1.00
R4677:Cdon	UTSW	9	35478605	missense	probably damaging	1.00
R4869:Cdon	UTSW	9	35452904	missense	possibly damaging	0.71
R5032:Cdon	UTSW	9	35489034	missense	probably damaging	1.00
R5047:Cdon	UTSW	9	35478639	missense	probably damaging	1.00
R5214:Cdon	UTSW	9	35483208	missense	probably damaging	1.00
R5341:Cdon	UTSW	9	35470135	missense	probably damaging	1.00
R5410:Cdon	UTSW	9	35470035	missense	probably damaging	0.99
R5581:Cdon	UTSW	9	35504081	missense	probably benign	0.01
R5696:Cdon	UTSW	9	35491866	missense	possibly damaging	0.69
R5757:Cdon	UTSW	9	35452772	missense	probably damaging	0.98
R5802:Cdon	UTSW	9	35454420	missense	probably damaging	0.99
R5845:Cdon	UTSW	9	35457466	missense	probably damaging	1.00
R5949:Cdon	UTSW	9	35486951	missense	probably benign	0.32
R6106:Cdon	UTSW	9	35455408	nonsense	probably null
R6245:Cdon	UTSW	9	35476939	missense	probably damaging	1.00
R6845:Cdon	UTSW	9	35486956	nonsense	probably null
R6896:Cdon	UTSW	9	35452106	start codon destroyed	probably null	1.00
R7060:Cdon	UTSW	9	35486909	missense	probably damaging	1.00
R7184:Cdon	UTSW	9	35463895	missense	probably benign	0.15
R7382:Cdon	UTSW	9	35478648	missense	probably damaging	1.00
R7763:Cdon	UTSW	9	35454415	nonsense	probably null
R7857:Cdon	UTSW	9	35456612	missense	possibly damaging	0.79
R7885:Cdon	UTSW	9	35456522	missense	probably benign	0.01
R7894:Cdon	UTSW	9	35476948	missense	probably damaging	1.00
R7940:Cdon	UTSW	9	35456612	missense	possibly damaging	0.79
R7968:Cdon	UTSW	9	35456522	missense	probably benign	0.01
R7977:Cdon	UTSW	9	35476948	missense	probably damaging	1.00
Z1177:Cdon	UTSW	9	35491900	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGCAGGACTTACTTTTGTGTG -3'
(R):5'- AGTGATCCCCTGTTTTCCAG -3'

Sequencing Primer
(F):5'- GGTCATTCTGAAGCAGAG -3'
(R):5'- CAGTTACTGGCTTGCAGT -3'

Posted On

2019-05-15