Incidental Mutation 'R0613:Xpnpep1'
ID54923
Institutional Source Beutler Lab
Gene Symbol Xpnpep1
Ensembl Gene ENSMUSG00000025027
Gene NameX-prolyl aminopeptidase (aminopeptidase P) 1, soluble
SynonymsD230045I08Rik
MMRRC Submission 038802-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0613 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location52943417-53040214 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 53006353 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 238 (D238E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182500] [ENSMUST00000183108] [ENSMUST00000183274]
Predicted Effect probably damaging
Transcript: ENSMUST00000069988
AA Change: D238E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000070946
Gene: ENSMUSG00000025027
AA Change: D238E

DomainStartEndE-ValueType
Pfam:Creatinase_N 10 154 5.2e-15 PFAM
Pfam:Creatinase_N_2 157 326 1.4e-47 PFAM
Pfam:Peptidase_M24 328 544 7.2e-52 PFAM
Pfam:Peptidase_M24_C 555 619 7.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182877
Predicted Effect possibly damaging
Transcript: ENSMUST00000183108
AA Change: D281E

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138250
Gene: ENSMUSG00000025027
AA Change: D281E

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 5.5e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183188
Predicted Effect possibly damaging
Transcript: ENSMUST00000183274
AA Change: D281E

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138233
Gene: ENSMUSG00000025027
AA Change: D281E

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 1.9e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184510
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of a metalloaminopeptidase that catalyzes the cleavage of the N-terminal amino acid adjacent to a proline residue. The gene product may play a role in degradation and maturation of tachykinins, neuropeptides, and peptide hormones. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit pre and postnatal lethality, reduced male survival, growth retardation with decreased body weight, size and length, microcephaly and peptiduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acd A T 8: 105,700,568 probably null Het
Adcy9 A G 16: 4,419,539 S3P probably damaging Het
Adgrl4 T C 3: 151,543,222 probably benign Het
Aff3 T C 1: 38,209,923 E700G probably benign Het
Ahctf1 A G 1: 179,769,414 S56P probably damaging Het
Atp12a T A 14: 56,374,521 I384N probably damaging Het
Brca1 A T 11: 101,508,210 S1519T probably benign Het
Ccl25 T C 8: 4,349,850 V94A probably benign Het
Cep170 T C 1: 176,774,680 T287A probably benign Het
Ces1a A G 8: 93,025,581 S383P probably benign Het
Cntnap3 A T 13: 64,758,414 F793I probably damaging Het
Ctsm T C 13: 61,539,682 R89G probably damaging Het
Cyp2j12 T G 4: 96,102,079 T417P probably damaging Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Edn2 T A 4: 120,161,864 probably null Het
Emc1 T A 4: 139,375,072 probably benign Het
Fam189a2 T A 19: 23,986,489 N239Y probably damaging Het
Fras1 T C 5: 96,700,488 probably benign Het
Fsip2 A T 2: 82,993,795 D6624V probably damaging Het
Gpr107 A G 2: 31,178,285 Y253C probably damaging Het
Gpr108 A G 17: 57,238,174 probably benign Het
Grik1 A G 16: 88,051,333 probably null Het
Gtf3c1 G A 7: 125,644,134 P1766L possibly damaging Het
Gucy2c A T 6: 136,760,723 N293K probably damaging Het
Hps6 C A 19: 46,003,821 P66T probably benign Het
Hspa9 A T 18: 34,947,980 V216E probably damaging Het
Igsf8 T A 1: 172,317,589 M224K probably benign Het
Igsf9b T C 9: 27,326,920 V569A probably damaging Het
Itgb4 A T 11: 115,993,342 I952F probably damaging Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Khdrbs2 A G 1: 32,657,522 H344R possibly damaging Het
Kmo C A 1: 175,637,892 R71S probably damaging Het
Lrrc31 A G 3: 30,685,035 probably benign Het
Map1b T A 13: 99,441,641 D168V probably damaging Het
Mfsd6 T C 1: 52,658,696 probably benign Het
Mgst1 G A 6: 138,156,245 G186D probably damaging Het
Mrc1 C T 2: 14,294,819 A740V probably damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mtor T C 4: 148,526,046 Y1605H possibly damaging Het
Ncoa4 T A 14: 32,176,552 L443Q probably damaging Het
Nelfa G A 5: 33,903,463 probably benign Het
Nepn T A 10: 52,401,257 L363Q probably damaging Het
Nfat5 A G 8: 107,366,295 T630A possibly damaging Het
Nipal4 A T 11: 46,150,384 V328E probably benign Het
Olfr1228 A T 2: 89,249,125 C178S probably damaging Het
Olfr1391 T A 11: 49,327,748 S112R possibly damaging Het
Olfr462 A T 11: 87,889,227 V223E possibly damaging Het
Olfr747 T A 14: 50,681,404 I77F probably benign Het
Olfr809 T A 10: 129,776,262 M116K probably damaging Het
Olfr924 T A 9: 38,848,613 C166* probably null Het
Otogl A T 10: 107,817,070 N1140K probably damaging Het
Ppip5k2 A C 1: 97,752,740 Y236* probably null Het
Prelid1 C T 13: 55,324,343 R111* probably null Het
Prpf8 T C 11: 75,503,444 L1771P probably damaging Het
Ptprb A T 10: 116,302,325 Y378F possibly damaging Het
Ptprb A G 10: 116,302,378 T396A possibly damaging Het
Rab3il1 T C 19: 10,028,364 L174P probably damaging Het
Rab4a T C 8: 123,823,835 V18A possibly damaging Het
Scn3a T A 2: 65,472,284 M1273L possibly damaging Het
Sdhc A T 1: 171,129,844 V156E probably benign Het
Slco3a1 T C 7: 74,346,634 probably benign Het
Syne3 T C 12: 104,958,112 T343A probably benign Het
Syt11 A G 3: 88,762,469 C39R probably damaging Het
Tll2 G T 19: 41,104,990 D462E probably damaging Het
Tmem132e T A 11: 82,438,338 V481D probably damaging Het
Tmem161b C T 13: 84,251,320 L17F probably damaging Het
Vmn2r105 T A 17: 20,208,316 I833F probably damaging Het
Vstm2a A T 11: 16,263,140 N175I probably damaging Het
Zfp112 G A 7: 24,127,028 G807D probably benign Het
Zfp518b A T 5: 38,673,603 V353E probably damaging Het
Zfp69 T C 4: 120,934,347 E39G probably benign Het
Zfp865 A G 7: 5,029,091 H25R possibly damaging Het
Other mutations in Xpnpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Xpnpep1 APN 19 53010148 missense probably benign 0.06
IGL01665:Xpnpep1 APN 19 52997032 missense probably benign 0.00
IGL01833:Xpnpep1 APN 19 53000393 missense probably damaging 1.00
IGL02011:Xpnpep1 APN 19 53002465 critical splice donor site probably benign 0.00
IGL03229:Xpnpep1 APN 19 53025380 missense probably benign
IGL03334:Xpnpep1 APN 19 53010146 missense probably damaging 1.00
R0226:Xpnpep1 UTSW 19 53010152 missense probably benign 0.03
R0648:Xpnpep1 UTSW 19 52997863 splice site probably benign
R1543:Xpnpep1 UTSW 19 52991676 missense probably benign 0.24
R1553:Xpnpep1 UTSW 19 53006338 missense probably benign 0.00
R1801:Xpnpep1 UTSW 19 53010133 missense probably damaging 1.00
R1853:Xpnpep1 UTSW 19 53006210 missense probably benign 0.01
R2234:Xpnpep1 UTSW 19 53013461 missense probably damaging 1.00
R3797:Xpnpep1 UTSW 19 53006342 missense probably benign 0.28
R3820:Xpnpep1 UTSW 19 53003819 splice site probably benign
R3822:Xpnpep1 UTSW 19 53003819 splice site probably benign
R3925:Xpnpep1 UTSW 19 52991697 missense probably damaging 1.00
R4831:Xpnpep1 UTSW 19 53014622 missense probably benign 0.09
R5033:Xpnpep1 UTSW 19 53006175 missense probably benign
R5184:Xpnpep1 UTSW 19 53013414 missense probably benign 0.24
R5468:Xpnpep1 UTSW 19 52995519 missense probably benign 0.01
R5573:Xpnpep1 UTSW 19 53004822 missense probably damaging 1.00
R5876:Xpnpep1 UTSW 19 52997008 missense probably damaging 1.00
R5929:Xpnpep1 UTSW 19 53013489 missense probably damaging 1.00
R6454:Xpnpep1 UTSW 19 52997879 missense possibly damaging 0.91
R6519:Xpnpep1 UTSW 19 53011844 missense possibly damaging 0.90
R7095:Xpnpep1 UTSW 19 53011765 critical splice donor site probably null
R7112:Xpnpep1 UTSW 19 53010107 missense probably benign
R7412:Xpnpep1 UTSW 19 53006291 missense probably benign
R8329:Xpnpep1 UTSW 19 53002472 critical splice donor site probably null
R8431:Xpnpep1 UTSW 19 52995506 missense probably benign 0.04
RF017:Xpnpep1 UTSW 19 53032060 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AGAGTTTACAGAGCCTCATCCGCC -3'
(R):5'- TGTAAGTGTGGGACCATCCCGTTAG -3'

Sequencing Primer
(F):5'- AAAGCCCAGATCTCTGTTTCAG -3'
(R):5'- CATCCCGTTAGGAGCTGTC -3'
Posted On2013-07-11