Incidental Mutation 'R7076:Dgka'
ID549232
Institutional Source Beutler Lab
Gene Symbol Dgka
Ensembl Gene ENSMUSG00000025357
Gene Namediacylglycerol kinase, alpha
SynonymsDagk1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R7076 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128720134-128744855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 128733583 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 153 (D153E)
Ref Sequence ENSEMBL: ENSMUSP00000026414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026414] [ENSMUST00000219834]
Predicted Effect probably damaging
Transcript: ENSMUST00000026414
AA Change: D153E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026414
Gene: ENSMUSG00000025357
AA Change: D153E

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 4 93 6.9e-31 PFAM
EFh 115 143 3.82e0 SMART
EFh 160 188 1.29e-4 SMART
C1 207 254 2.29e-10 SMART
C1 269 320 6.91e-5 SMART
DAGKc 372 495 3.11e-62 SMART
DAGKa 515 696 4.1e-103 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000219834
AA Change: D153E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It acts as a modulator that competes with protein kinase C for the second messenger diacylglycerol in intracellular signaling pathways. It also plays an important role in the resynthesis of phosphatidylinositols and phosphorylating diacylglycerol to phosphatidic acid. Alternative splicing occurs at this locus and four transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired induction of T cell anergy. T cells stimulated in anergy producing conditions show increased proliferation and interleukin 2 production. Mice homozygous for a transgenic gene disruption exhibit male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 A G 8: 55,871,659 C587R probably damaging Het
Adgrg7 T C 16: 56,742,406 T523A probably damaging Het
Arrdc3 A T 13: 80,890,696 K259M probably damaging Het
Becn1 A T 11: 101,295,324 N151K probably benign Het
Cars2 C T 8: 11,529,649 E270K probably damaging Het
Ccp110 C A 7: 118,732,405 P943Q probably damaging Het
Ccser2 A G 14: 36,939,829 I466T probably benign Het
Cd164 A G 10: 41,523,197 E94G probably benign Het
Cdon C T 9: 35,504,150 T1228I probably benign Het
Cubn C A 2: 13,306,280 V3145L probably benign Het
Cubn T A 2: 13,306,281 K3144N probably benign Het
Dchs1 A G 7: 105,761,871 V1649A probably benign Het
Dip2b A G 15: 100,157,972 probably null Het
Dnajc21 T C 15: 10,449,631 T435A probably benign Het
F830016B08Rik A T 18: 60,300,471 I209F probably damaging Het
Ghdc C A 11: 100,769,714 S111I possibly damaging Het
Gm19965 T C 1: 116,821,275 C229R Het
Gpm6a C T 8: 55,037,451 T54I probably damaging Het
Gpr171 G T 3: 59,098,156 A66E probably damaging Het
Grm7 A G 6: 111,358,152 D508G probably benign Het
Has1 G A 17: 17,843,806 R524C probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv3-8 A T 12: 114,322,782 L7Q probably damaging Het
Ints10 A T 8: 68,796,751 R78* probably null Het
Itpr1 A G 6: 108,388,296 I903V probably benign Het
Lrp1 A G 10: 127,550,183 probably null Het
Mki67 A G 7: 135,705,629 V132A probably damaging Het
Myh4 A G 11: 67,253,173 E1123G possibly damaging Het
Neurog3 A G 10: 62,133,580 T40A probably benign Het
Nipsnap3b T A 4: 53,021,095 probably null Het
Nr4a3 G A 4: 48,055,957 V328I probably damaging Het
Olfr1489 G T 19: 13,633,880 M256I possibly damaging Het
Olfr313 G A 11: 58,817,164 R52Q probably benign Het
Olfr487 A T 7: 108,211,998 V177D probably damaging Het
Olfr654 A T 7: 104,588,223 S140C probably damaging Het
Olfr716 T C 7: 107,148,029 F238L probably damaging Het
Olfr743 T A 14: 50,533,821 Y136* probably null Het
Osbpl5 A G 7: 143,709,840 L102P probably benign Het
Ppl C T 16: 5,100,119 R503Q probably damaging Het
Ppp2r2d T C 7: 138,876,597 M321T possibly damaging Het
Prex1 T C 2: 166,633,382 Y197C probably damaging Het
Prss32 A G 17: 23,853,921 D42G possibly damaging Het
Ralgapa1 T C 12: 55,721,576 E1210G possibly damaging Het
Sdr16c5 A G 4: 4,006,591 C234R probably damaging Het
Slc23a4 A G 6: 34,956,884 S95P probably damaging Het
Srp14 T C 2: 118,479,390 T29A probably damaging Het
Tet2 T A 3: 133,467,023 H1826L possibly damaging Het
Tfr2 A T 5: 137,583,574 Y641F probably damaging Het
Tmco5b A G 2: 113,287,421 N27D probably damaging Het
Tvp23a T C 16: 10,428,735 D62G probably benign Het
Usp12 A G 5: 146,737,752 F347S possibly damaging Het
Zfp407 A T 18: 84,558,476 L1504Q probably damaging Het
Zfp524 A G 7: 5,017,896 D141G possibly damaging Het
Zfp68 A G 5: 138,606,939 I374T possibly damaging Het
Zfp758 C T 17: 22,375,156 H208Y probably benign Het
Zfp804b T C 5: 6,769,751 H1104R probably benign Het
Znrf2 T A 6: 54,842,695 *75K probably null Het
Zzef1 T C 11: 72,899,559 V2113A probably benign Het
Other mutations in Dgka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dgka APN 10 128733086 missense probably damaging 1.00
IGL02479:Dgka APN 10 128730246 missense probably benign 0.01
IGL02727:Dgka APN 10 128722448 splice site probably benign
IGL02817:Dgka APN 10 128730228 missense probably benign
IGL02882:Dgka APN 10 128733384 missense possibly damaging 0.77
IGL03239:Dgka APN 10 128721385 splice site probably benign
R0321:Dgka UTSW 10 128721083 splice site probably benign
R0374:Dgka UTSW 10 128721083 splice site probably benign
R0482:Dgka UTSW 10 128734121 nonsense probably null
R0494:Dgka UTSW 10 128721083 splice site probably benign
R0573:Dgka UTSW 10 128737007 critical splice donor site probably null
R0594:Dgka UTSW 10 128733110 splice site probably benign
R0607:Dgka UTSW 10 128720469 splice site probably null
R0618:Dgka UTSW 10 128721083 splice site probably benign
R0691:Dgka UTSW 10 128723260 splice site probably benign
R1378:Dgka UTSW 10 128735827 splice site probably null
R1424:Dgka UTSW 10 128733333 missense possibly damaging 0.57
R1955:Dgka UTSW 10 128730189 critical splice donor site probably null
R1972:Dgka UTSW 10 128720466 missense probably damaging 0.99
R1998:Dgka UTSW 10 128729939 missense probably benign 0.00
R2046:Dgka UTSW 10 128723535 missense probably damaging 1.00
R4206:Dgka UTSW 10 128721195 missense probably damaging 1.00
R4418:Dgka UTSW 10 128728094 missense probably damaging 1.00
R4752:Dgka UTSW 10 128736659 missense probably benign 0.03
R5092:Dgka UTSW 10 128735833 missense probably damaging 0.99
R5479:Dgka UTSW 10 128729672 critical splice acceptor site probably null
R6009:Dgka UTSW 10 128723679 missense probably damaging 1.00
R6273:Dgka UTSW 10 128723646 missense probably benign 0.03
R6852:Dgka UTSW 10 128722539 missense probably damaging 1.00
R6947:Dgka UTSW 10 128733015 missense probably damaging 1.00
R6973:Dgka UTSW 10 128729594 splice site probably null
R7024:Dgka UTSW 10 128720487 missense probably damaging 1.00
R7290:Dgka UTSW 10 128733599 missense probably damaging 0.99
R7397:Dgka UTSW 10 128720725 missense possibly damaging 0.95
R7823:Dgka UTSW 10 128736266 missense probably benign 0.00
R7856:Dgka UTSW 10 128736664 missense probably benign
R8118:Dgka UTSW 10 128722449 splice site probably null
R8360:Dgka UTSW 10 128728128 missense probably damaging 0.99
R8374:Dgka UTSW 10 128721243 missense probably benign 0.01
X0020:Dgka UTSW 10 128721317 missense probably damaging 1.00
Z1177:Dgka UTSW 10 128720468 missense probably benign 0.00
Z1177:Dgka UTSW 10 128731165 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TCATCTCCTGAAGGATCTGATCAG -3'
(R):5'- ACTTGTCAGAGGTACCTGAGAAC -3'

Sequencing Primer
(F):5'- CTCCTGAAGGATCTGATCAGACAGG -3'
(R):5'- TACCTGAGAACAAGAGGTGATTCTG -3'
Posted On2019-05-15