Incidental Mutation 'R7076:Becn1'
ID549237
Institutional Source Beutler Lab
Gene Symbol Becn1
Ensembl Gene ENSMUSG00000035086
Gene Namebeclin 1, autophagy related
SynonymsAtg6
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7076 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location101285952-101302286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101295324 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 151 (N151K)
Ref Sequence ENSEMBL: ENSMUSP00000119369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041403] [ENSMUST00000126195] [ENSMUST00000129863] [ENSMUST00000130916] [ENSMUST00000140706] [ENSMUST00000167667] [ENSMUST00000167818] [ENSMUST00000170502] [ENSMUST00000172233]
PDB Structure
Crystal Structure of M11, the BCL-2 Homolog of Murine Gamma-herpesvirus 68, Complexed with Mouse Beclin1 (residues 106-124) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000041403
Predicted Effect possibly damaging
Transcript: ENSMUST00000126195
AA Change: N83K

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122168
Gene: ENSMUSG00000035086
AA Change: N83K

DomainStartEndE-ValueType
Pfam:BH3 35 59 5.6e-22 PFAM
Pfam:APG6 65 147 1.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129863
SMART Domains Protein: ENSMUSP00000116580
Gene: ENSMUSG00000035086

DomainStartEndE-ValueType
Pfam:APG6 6 125 1.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130916
AA Change: N151K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119369
Gene: ENSMUSG00000035086
AA Change: N151K

DomainStartEndE-ValueType
Pfam:BH3 103 127 4.1e-20 PFAM
Pfam:APG6 133 444 1.1e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140706
Predicted Effect probably benign
Transcript: ENSMUST00000167667
Predicted Effect probably benign
Transcript: ENSMUST00000167818
Predicted Effect probably benign
Transcript: ENSMUST00000170502
Predicted Effect probably benign
Transcript: ENSMUST00000172233
SMART Domains Protein: ENSMUSP00000129156
Gene: ENSMUSG00000035086

DomainStartEndE-ValueType
Pfam:APG6 79 274 3.7e-75 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates autophagy, a catabolic process of degradation induced by starvation. The encoded protein is a component of the phosphatidylinositol-3-kinase (PI3K) complex which mediates vesicle-trafficking processes. This protein is thought to play a role in multiple cellular processes, including tumorigenesis, neurodegeneration and apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit premature death, increased tumor incidence and reduced autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 A G 8: 55,871,659 C587R probably damaging Het
Adgrg7 T C 16: 56,742,406 T523A probably damaging Het
Arrdc3 A T 13: 80,890,696 K259M probably damaging Het
Cars2 C T 8: 11,529,649 E270K probably damaging Het
Ccp110 C A 7: 118,732,405 P943Q probably damaging Het
Ccser2 A G 14: 36,939,829 I466T probably benign Het
Cd164 A G 10: 41,523,197 E94G probably benign Het
Cdon C T 9: 35,504,150 T1228I probably benign Het
Cubn C A 2: 13,306,280 V3145L probably benign Het
Cubn T A 2: 13,306,281 K3144N probably benign Het
Dchs1 A G 7: 105,761,871 V1649A probably benign Het
Dgka A T 10: 128,733,583 D153E probably damaging Het
Dip2b A G 15: 100,157,972 probably null Het
Dnajc21 T C 15: 10,449,631 T435A probably benign Het
F830016B08Rik A T 18: 60,300,471 I209F probably damaging Het
Ghdc C A 11: 100,769,714 S111I possibly damaging Het
Gm19965 T C 1: 116,821,275 C229R Het
Gpm6a C T 8: 55,037,451 T54I probably damaging Het
Gpr171 G T 3: 59,098,156 A66E probably damaging Het
Grm7 A G 6: 111,358,152 D508G probably benign Het
Has1 G A 17: 17,843,806 R524C probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv3-8 A T 12: 114,322,782 L7Q probably damaging Het
Ints10 A T 8: 68,796,751 R78* probably null Het
Itpr1 A G 6: 108,388,296 I903V probably benign Het
Lrp1 A G 10: 127,550,183 probably null Het
Mki67 A G 7: 135,705,629 V132A probably damaging Het
Myh4 A G 11: 67,253,173 E1123G possibly damaging Het
Neurog3 A G 10: 62,133,580 T40A probably benign Het
Nipsnap3b T A 4: 53,021,095 probably null Het
Nr4a3 G A 4: 48,055,957 V328I probably damaging Het
Olfr1489 G T 19: 13,633,880 M256I possibly damaging Het
Olfr313 G A 11: 58,817,164 R52Q probably benign Het
Olfr487 A T 7: 108,211,998 V177D probably damaging Het
Olfr654 A T 7: 104,588,223 S140C probably damaging Het
Olfr716 T C 7: 107,148,029 F238L probably damaging Het
Olfr743 T A 14: 50,533,821 Y136* probably null Het
Osbpl5 A G 7: 143,709,840 L102P probably benign Het
Ppl C T 16: 5,100,119 R503Q probably damaging Het
Ppp2r2d T C 7: 138,876,597 M321T possibly damaging Het
Prex1 T C 2: 166,633,382 Y197C probably damaging Het
Prss32 A G 17: 23,853,921 D42G possibly damaging Het
Ralgapa1 T C 12: 55,721,576 E1210G possibly damaging Het
Sdr16c5 A G 4: 4,006,591 C234R probably damaging Het
Slc23a4 A G 6: 34,956,884 S95P probably damaging Het
Srp14 T C 2: 118,479,390 T29A probably damaging Het
Tet2 T A 3: 133,467,023 H1826L possibly damaging Het
Tfr2 A T 5: 137,583,574 Y641F probably damaging Het
Tmco5b A G 2: 113,287,421 N27D probably damaging Het
Tvp23a T C 16: 10,428,735 D62G probably benign Het
Usp12 A G 5: 146,737,752 F347S possibly damaging Het
Zfp407 A T 18: 84,558,476 L1504Q probably damaging Het
Zfp524 A G 7: 5,017,896 D141G possibly damaging Het
Zfp68 A G 5: 138,606,939 I374T possibly damaging Het
Zfp758 C T 17: 22,375,156 H208Y probably benign Het
Zfp804b T C 5: 6,769,751 H1104R probably benign Het
Znrf2 T A 6: 54,842,695 *75K probably null Het
Zzef1 T C 11: 72,899,559 V2113A probably benign Het
Other mutations in Becn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Becn1 APN 11 101295622 missense probably benign 0.39
IGL01296:Becn1 APN 11 101291451 missense probably damaging 1.00
IGL01303:Becn1 APN 11 101294985 missense possibly damaging 0.92
IGL01311:Becn1 APN 11 101291516 missense probably damaging 1.00
IGL02269:Becn1 APN 11 101291535 splice site probably benign
IGL02472:Becn1 APN 11 101291398 missense probably benign 0.03
indisposed UTSW 11 101291510 missense probably damaging 1.00
R0123:Becn1 UTSW 11 101290498 missense probably damaging 1.00
R0147:Becn1 UTSW 11 101301736 missense probably damaging 1.00
R0453:Becn1 UTSW 11 101290449 missense probably damaging 1.00
R1422:Becn1 UTSW 11 101295126 missense possibly damaging 0.92
R1840:Becn1 UTSW 11 101295566 missense probably damaging 1.00
R4097:Becn1 UTSW 11 101294266 intron probably benign
R5041:Becn1 UTSW 11 101288836 missense probably benign 0.30
R5119:Becn1 UTSW 11 101291395 missense probably damaging 1.00
R5319:Becn1 UTSW 11 101288803 utr 3 prime probably benign
R5602:Becn1 UTSW 11 101288952 missense probably damaging 1.00
R6178:Becn1 UTSW 11 101291510 missense probably damaging 1.00
R6190:Becn1 UTSW 11 101295374 missense probably damaging 1.00
R7438:Becn1 UTSW 11 101294226 missense probably benign 0.00
R7831:Becn1 UTSW 11 101290453 missense probably benign 0.00
R8220:Becn1 UTSW 11 101296279 missense possibly damaging 0.95
X0011:Becn1 UTSW 11 101289822 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TCTAGGATCTCCAAACAGCGTCTG -3'
(R):5'- GAGACTCAAGGCAAGTTGGTC -3'

Sequencing Primer
(F):5'- AACAGCGTCTGCCAAGG -3'
(R):5'- GACTCAAGGCAAGTTGGTCTAATTTC -3'
Posted On2019-05-15