Incidental Mutation 'R7076:Arrdc3'
ID549240
Institutional Source Beutler Lab
Gene Symbol Arrdc3
Ensembl Gene ENSMUSG00000074794
Gene Namearrestin domain containing 3
SynonymsmKIAA1376; AI450344
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R7076 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location80883384-80896042 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80890696 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 259 (K259M)
Ref Sequence ENSEMBL: ENSMUSP00000096957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099356] [ENSMUST00000159690] [ENSMUST00000161441]
Predicted Effect probably damaging
Transcript: ENSMUST00000099356
AA Change: K259M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096957
Gene: ENSMUSG00000074794
AA Change: K259M

DomainStartEndE-ValueType
Pfam:Arrestin_N 9 165 3.4e-35 PFAM
Arrestin_C 187 314 1.25e-29 SMART
low complexity region 319 331 N/A INTRINSIC
low complexity region 335 347 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159690
AA Change: K259M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124418
Gene: ENSMUSG00000074794
AA Change: K259M

DomainStartEndE-ValueType
Pfam:Arrestin_N 9 165 3.5e-38 PFAM
Arrestin_C 187 314 1.25e-29 SMART
low complexity region 319 331 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161441
AA Change: K39M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125455
Gene: ENSMUSG00000074794
AA Change: K39M

DomainStartEndE-ValueType
Pfam:Arrestin_C 4 94 2e-10 PFAM
low complexity region 99 111 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
Meta Mutation Damage Score 0.2346 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arrestin family of proteins, which regulate G protein-mediated signaling. The encoded protein is thought to act as a regulator of breast cancer growth and progression by binding to a phosphorylated form of integrin beta4, a tumor-related antigen, targeting the integrin for internalization and degradation. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit resistance to age-related obesity, insulin resistance, and hepatic steatosis. Mice homozygous for a different gene trap allele exhibit resistance to obesity, embryonic lethality when dams are fed a standard chow and dandruff due to very thin skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 A G 8: 55,871,659 C587R probably damaging Het
Adgrg7 T C 16: 56,742,406 T523A probably damaging Het
Becn1 A T 11: 101,295,324 N151K probably benign Het
Cars2 C T 8: 11,529,649 E270K probably damaging Het
Ccp110 C A 7: 118,732,405 P943Q probably damaging Het
Ccser2 A G 14: 36,939,829 I466T probably benign Het
Cd164 A G 10: 41,523,197 E94G probably benign Het
Cdon C T 9: 35,504,150 T1228I probably benign Het
Cubn C A 2: 13,306,280 V3145L probably benign Het
Cubn T A 2: 13,306,281 K3144N probably benign Het
Dchs1 A G 7: 105,761,871 V1649A probably benign Het
Dgka A T 10: 128,733,583 D153E probably damaging Het
Dip2b A G 15: 100,157,972 probably null Het
Dnajc21 T C 15: 10,449,631 T435A probably benign Het
F830016B08Rik A T 18: 60,300,471 I209F probably damaging Het
Ghdc C A 11: 100,769,714 S111I possibly damaging Het
Gm19965 T C 1: 116,821,275 C229R Het
Gpm6a C T 8: 55,037,451 T54I probably damaging Het
Gpr171 G T 3: 59,098,156 A66E probably damaging Het
Grm7 A G 6: 111,358,152 D508G probably benign Het
Has1 G A 17: 17,843,806 R524C probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv3-8 A T 12: 114,322,782 L7Q probably damaging Het
Ints10 A T 8: 68,796,751 R78* probably null Het
Itpr1 A G 6: 108,388,296 I903V probably benign Het
Lrp1 A G 10: 127,550,183 probably null Het
Mki67 A G 7: 135,705,629 V132A probably damaging Het
Myh4 A G 11: 67,253,173 E1123G possibly damaging Het
Neurog3 A G 10: 62,133,580 T40A probably benign Het
Nipsnap3b T A 4: 53,021,095 probably null Het
Nr4a3 G A 4: 48,055,957 V328I probably damaging Het
Olfr1489 G T 19: 13,633,880 M256I possibly damaging Het
Olfr313 G A 11: 58,817,164 R52Q probably benign Het
Olfr487 A T 7: 108,211,998 V177D probably damaging Het
Olfr654 A T 7: 104,588,223 S140C probably damaging Het
Olfr716 T C 7: 107,148,029 F238L probably damaging Het
Olfr743 T A 14: 50,533,821 Y136* probably null Het
Osbpl5 A G 7: 143,709,840 L102P probably benign Het
Ppl C T 16: 5,100,119 R503Q probably damaging Het
Ppp2r2d T C 7: 138,876,597 M321T possibly damaging Het
Prex1 T C 2: 166,633,382 Y197C probably damaging Het
Prss32 A G 17: 23,853,921 D42G possibly damaging Het
Ralgapa1 T C 12: 55,721,576 E1210G possibly damaging Het
Sdr16c5 A G 4: 4,006,591 C234R probably damaging Het
Slc23a4 A G 6: 34,956,884 S95P probably damaging Het
Srp14 T C 2: 118,479,390 T29A probably damaging Het
Tet2 T A 3: 133,467,023 H1826L possibly damaging Het
Tfr2 A T 5: 137,583,574 Y641F probably damaging Het
Tmco5b A G 2: 113,287,421 N27D probably damaging Het
Tvp23a T C 16: 10,428,735 D62G probably benign Het
Usp12 A G 5: 146,737,752 F347S possibly damaging Het
Zfp407 A T 18: 84,558,476 L1504Q probably damaging Het
Zfp524 A G 7: 5,017,896 D141G possibly damaging Het
Zfp68 A G 5: 138,606,939 I374T possibly damaging Het
Zfp758 C T 17: 22,375,156 H208Y probably benign Het
Zfp804b T C 5: 6,769,751 H1104R probably benign Het
Znrf2 T A 6: 54,842,695 *75K probably null Het
Zzef1 T C 11: 72,899,559 V2113A probably benign Het
Other mutations in Arrdc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Arrdc3 APN 13 80890572 missense probably damaging 1.00
IGL00933:Arrdc3 APN 13 80891055 splice site probably benign
IGL02006:Arrdc3 APN 13 80883774 missense probably damaging 1.00
IGL02009:Arrdc3 APN 13 80893380 missense probably benign 0.20
IGL02272:Arrdc3 APN 13 80891650 splice site probably benign
IGL02634:Arrdc3 APN 13 80890765 missense probably damaging 1.00
IGL03337:Arrdc3 APN 13 80890647 missense probably benign 0.01
R0008:Arrdc3 UTSW 13 80891075 missense probably damaging 1.00
R0008:Arrdc3 UTSW 13 80883892 nonsense probably null
R0008:Arrdc3 UTSW 13 80891075 missense probably damaging 1.00
R0838:Arrdc3 UTSW 13 80889247 splice site probably benign
R0843:Arrdc3 UTSW 13 80890803 splice site probably benign
R1211:Arrdc3 UTSW 13 80890698 missense possibly damaging 0.76
R1404:Arrdc3 UTSW 13 80883854 missense probably damaging 1.00
R1404:Arrdc3 UTSW 13 80883854 missense probably damaging 1.00
R1992:Arrdc3 UTSW 13 80883689 missense probably damaging 1.00
R4446:Arrdc3 UTSW 13 80889063 intron probably benign
R4540:Arrdc3 UTSW 13 80890671 missense possibly damaging 0.95
R4718:Arrdc3 UTSW 13 80883867 missense possibly damaging 0.48
R5138:Arrdc3 UTSW 13 80891065 missense probably damaging 1.00
R5814:Arrdc3 UTSW 13 80890579 missense possibly damaging 0.92
R6514:Arrdc3 UTSW 13 80889190 missense probably damaging 1.00
R6899:Arrdc3 UTSW 13 80889211 missense probably damaging 0.99
R6985:Arrdc3 UTSW 13 80883657 missense probably damaging 0.99
R7670:Arrdc3 UTSW 13 80889093 missense probably damaging 1.00
R8342:Arrdc3 UTSW 13 80883671 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCCTCTGCAGGTGAATCAATCC -3'
(R):5'- CCATGTTCTAGGCTTATGAGAGGTAG -3'

Sequencing Primer
(F):5'- CCAGATATTTGCCGAGATTGAGAAC -3'
(R):5'- TAAGTGGACTACGAAAACCATACTTG -3'
Posted On2019-05-15