Incidental Mutation 'R7076:Adgrg7'
ID549246
Institutional Source Beutler Lab
Gene Symbol Adgrg7
Ensembl Gene ENSMUSG00000022755
Gene Nameadhesion G protein-coupled receptor G7
SynonymsGpr128, 9130020O16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7076 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location56724609-56795855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56742406 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 523 (T523A)
Ref Sequence ENSEMBL: ENSMUSP00000023437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023437]
Predicted Effect probably damaging
Transcript: ENSMUST00000023437
AA Change: T523A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023437
Gene: ENSMUSG00000022755
AA Change: T523A

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
SCOP:d1edmb_ 52 76 1e-3 SMART
GPS 376 424 6.16e-8 SMART
Pfam:7tm_2 428 712 4.5e-40 PFAM
Meta Mutation Damage Score 0.1720 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight gain and increased frequency of peristalsis and slow wave potential in the small intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 A G 8: 55,871,659 C587R probably damaging Het
Arrdc3 A T 13: 80,890,696 K259M probably damaging Het
Becn1 A T 11: 101,295,324 N151K probably benign Het
Cars2 C T 8: 11,529,649 E270K probably damaging Het
Ccp110 C A 7: 118,732,405 P943Q probably damaging Het
Ccser2 A G 14: 36,939,829 I466T probably benign Het
Cd164 A G 10: 41,523,197 E94G probably benign Het
Cdon C T 9: 35,504,150 T1228I probably benign Het
Cubn C A 2: 13,306,280 V3145L probably benign Het
Cubn T A 2: 13,306,281 K3144N probably benign Het
Dchs1 A G 7: 105,761,871 V1649A probably benign Het
Dgka A T 10: 128,733,583 D153E probably damaging Het
Dip2b A G 15: 100,157,972 probably null Het
Dnajc21 T C 15: 10,449,631 T435A probably benign Het
F830016B08Rik A T 18: 60,300,471 I209F probably damaging Het
Ghdc C A 11: 100,769,714 S111I possibly damaging Het
Gm19965 T C 1: 116,821,275 C229R Het
Gpm6a C T 8: 55,037,451 T54I probably damaging Het
Gpr171 G T 3: 59,098,156 A66E probably damaging Het
Grm7 A G 6: 111,358,152 D508G probably benign Het
Has1 G A 17: 17,843,806 R524C probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv3-8 A T 12: 114,322,782 L7Q probably damaging Het
Ints10 A T 8: 68,796,751 R78* probably null Het
Itpr1 A G 6: 108,388,296 I903V probably benign Het
Lrp1 A G 10: 127,550,183 probably null Het
Mki67 A G 7: 135,705,629 V132A probably damaging Het
Myh4 A G 11: 67,253,173 E1123G possibly damaging Het
Neurog3 A G 10: 62,133,580 T40A probably benign Het
Nipsnap3b T A 4: 53,021,095 probably null Het
Nr4a3 G A 4: 48,055,957 V328I probably damaging Het
Olfr1489 G T 19: 13,633,880 M256I possibly damaging Het
Olfr313 G A 11: 58,817,164 R52Q probably benign Het
Olfr487 A T 7: 108,211,998 V177D probably damaging Het
Olfr654 A T 7: 104,588,223 S140C probably damaging Het
Olfr716 T C 7: 107,148,029 F238L probably damaging Het
Olfr743 T A 14: 50,533,821 Y136* probably null Het
Osbpl5 A G 7: 143,709,840 L102P probably benign Het
Ppl C T 16: 5,100,119 R503Q probably damaging Het
Ppp2r2d T C 7: 138,876,597 M321T possibly damaging Het
Prex1 T C 2: 166,633,382 Y197C probably damaging Het
Prss32 A G 17: 23,853,921 D42G possibly damaging Het
Ralgapa1 T C 12: 55,721,576 E1210G possibly damaging Het
Sdr16c5 A G 4: 4,006,591 C234R probably damaging Het
Slc23a4 A G 6: 34,956,884 S95P probably damaging Het
Srp14 T C 2: 118,479,390 T29A probably damaging Het
Tet2 T A 3: 133,467,023 H1826L possibly damaging Het
Tfr2 A T 5: 137,583,574 Y641F probably damaging Het
Tmco5b A G 2: 113,287,421 N27D probably damaging Het
Tvp23a T C 16: 10,428,735 D62G probably benign Het
Usp12 A G 5: 146,737,752 F347S possibly damaging Het
Zfp407 A T 18: 84,558,476 L1504Q probably damaging Het
Zfp524 A G 7: 5,017,896 D141G possibly damaging Het
Zfp68 A G 5: 138,606,939 I374T possibly damaging Het
Zfp758 C T 17: 22,375,156 H208Y probably benign Het
Zfp804b T C 5: 6,769,751 H1104R probably benign Het
Znrf2 T A 6: 54,842,695 *75K probably null Het
Zzef1 T C 11: 72,899,559 V2113A probably benign Het
Other mutations in Adgrg7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Adgrg7 APN 16 56747919 critical splice donor site probably null
IGL03122:Adgrg7 APN 16 56770362 splice site probably benign
R0632:Adgrg7 UTSW 16 56742589 missense possibly damaging 0.89
R0673:Adgrg7 UTSW 16 56773486 missense possibly damaging 0.48
R1690:Adgrg7 UTSW 16 56795630 missense probably damaging 0.99
R2009:Adgrg7 UTSW 16 56761873 missense probably benign 0.08
R2017:Adgrg7 UTSW 16 56732806 missense probably benign 0.02
R2132:Adgrg7 UTSW 16 56767918 missense probably damaging 1.00
R2153:Adgrg7 UTSW 16 56752428 missense possibly damaging 0.75
R2229:Adgrg7 UTSW 16 56752403 missense probably benign
R2436:Adgrg7 UTSW 16 56761945 missense possibly damaging 0.78
R2878:Adgrg7 UTSW 16 56750454 missense probably benign 0.14
R2981:Adgrg7 UTSW 16 56750406 critical splice donor site probably null
R4014:Adgrg7 UTSW 16 56742288 missense probably damaging 1.00
R4023:Adgrg7 UTSW 16 56730298 missense probably damaging 1.00
R4024:Adgrg7 UTSW 16 56730298 missense probably damaging 1.00
R4026:Adgrg7 UTSW 16 56730298 missense probably damaging 1.00
R4551:Adgrg7 UTSW 16 56748012 missense probably damaging 1.00
R4834:Adgrg7 UTSW 16 56732869 missense probably damaging 1.00
R5041:Adgrg7 UTSW 16 56730348 missense probably benign 0.21
R5145:Adgrg7 UTSW 16 56742319 missense probably benign 0.04
R5377:Adgrg7 UTSW 16 56730306 missense possibly damaging 0.68
R5549:Adgrg7 UTSW 16 56750427 missense probably damaging 1.00
R5915:Adgrg7 UTSW 16 56730385 splice site probably null
R5957:Adgrg7 UTSW 16 56773427 missense probably damaging 0.96
R6146:Adgrg7 UTSW 16 56773466 missense probably benign 0.21
R6198:Adgrg7 UTSW 16 56777193 missense possibly damaging 0.64
R6233:Adgrg7 UTSW 16 56778642 missense possibly damaging 0.52
R6337:Adgrg7 UTSW 16 56752425 missense probably damaging 0.96
R6633:Adgrg7 UTSW 16 56730286 missense probably benign 0.05
R6693:Adgrg7 UTSW 16 56770224 missense probably damaging 0.97
R6812:Adgrg7 UTSW 16 56795798 start gained probably benign
R6841:Adgrg7 UTSW 16 56750424 missense probably damaging 1.00
R6868:Adgrg7 UTSW 16 56773476 missense probably benign
R7146:Adgrg7 UTSW 16 56730242 missense probably damaging 1.00
R7232:Adgrg7 UTSW 16 56777152 splice site probably null
R7266:Adgrg7 UTSW 16 56770311 missense probably benign 0.00
R7376:Adgrg7 UTSW 16 56724979 missense probably damaging 1.00
R7390:Adgrg7 UTSW 16 56732844 missense probably damaging 0.98
R7401:Adgrg7 UTSW 16 56742418 missense probably benign 0.43
R7496:Adgrg7 UTSW 16 56732857 missense probably benign
R7540:Adgrg7 UTSW 16 56750429 missense probably damaging 1.00
R8147:Adgrg7 UTSW 16 56742513 missense probably damaging 1.00
R8354:Adgrg7 UTSW 16 56795682 start gained probably benign
R8372:Adgrg7 UTSW 16 56795751 start gained probably benign
R8393:Adgrg7 UTSW 16 56762114 missense probably damaging 1.00
R8454:Adgrg7 UTSW 16 56795682 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTGAATGGTTAGACCTCCAATGG -3'
(R):5'- AAACCTCAGTAACCTGGGTGTTG -3'

Sequencing Primer
(F):5'- AGACCTCCAATGGGTGTTTG -3'
(R):5'- CTCAGTAACCTGGGTGTTGGTCAG -3'
Posted On2019-05-15