Incidental Mutation 'R7077:Bok'
ID549254
Institutional Source Beutler Lab
Gene Symbol Bok
Ensembl Gene ENSMUSG00000026278
Gene NameBCL2-related ovarian killer
Synonymsmtd, matador
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7077 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location93685660-93695764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93689189 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 86 (Y86N)
Ref Sequence ENSEMBL: ENSMUSP00000027499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027499] [ENSMUST00000188394] [ENSMUST00000201863]
Predicted Effect probably damaging
Transcript: ENSMUST00000027499
AA Change: Y86N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027499
Gene: ENSMUSG00000026278
AA Change: Y86N

DomainStartEndE-ValueType
BCL 71 172 6.99e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188394
AA Change: Y86N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140412
Gene: ENSMUSG00000026278
AA Change: Y86N

DomainStartEndE-ValueType
Pfam:Bcl-2 71 121 8.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200888
Predicted Effect probably damaging
Transcript: ENSMUST00000201863
AA Change: Y86N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144347
Gene: ENSMUSG00000026278
AA Change: Y86N

DomainStartEndE-ValueType
BCL 71 172 6.99e-37 SMART
Meta Mutation Damage Score 0.9479 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the BCL2 family, members of which form homo- or heterodimers, and act as anti- or proapoptotic regulators that are involved in a wide variety of cellular processes. Studies in rat show that this protein has restricted expression in reproductive tissues, interacts strongly with some antiapoptotic BCL2 proteins, not at all with proapoptotic BCL2 proteins, and induces apoptosis in transfected cells. Thus, this protein represents a proapoptotic member of the BCL2 family. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit minor increase in spleen and thymus weight in female, but not male, mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 C T 12: 81,559,119 C623Y probably damaging Het
Ago3 T C 4: 126,371,532 K322R probably null Het
Ankrd17 T C 5: 90,285,864 H682R possibly damaging Het
Aoah A G 13: 20,910,106 D187G probably damaging Het
Arhgap17 T C 7: 123,280,008 D840G unknown Het
AW551984 C T 9: 39,591,427 V650I probably benign Het
BC051142 C A 17: 34,440,882 T93N possibly damaging Het
Ccdc146 T A 5: 21,305,274 N580I possibly damaging Het
Ccng2 T C 5: 93,269,340 S72P possibly damaging Het
Cfap74 T G 4: 155,455,677 I977S unknown Het
Cobl T C 11: 12,253,441 N1087S probably benign Het
Cyp21a1 C A 17: 34,802,359 R346L probably damaging Het
Eif4a1 A C 11: 69,670,664 F52L probably damaging Het
Eif4ebp2 A C 10: 61,433,801 I120S probably damaging Het
Enpp2 A C 15: 54,901,391 D146E probably benign Het
Exosc9 T C 3: 36,553,056 Y30H probably damaging Het
Fam117a G A 11: 95,377,672 G300S probably benign Het
Focad C A 4: 88,410,677 A1709E unknown Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Fsip2 T C 2: 82,983,152 F3272L probably benign Het
Gcnt2 G A 13: 40,860,420 M22I probably benign Het
Gjd4 T C 18: 9,280,928 E50G probably damaging Het
Gm10375 G T 14: 43,602,970 T162K probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gm4924 T C 10: 82,379,223 F952L unknown Het
Heatr1 T C 13: 12,418,164 F1132L possibly damaging Het
Hnrnpu A G 1: 178,332,191 Y442H unknown Het
Hp1bp3 C A 4: 138,239,618 T408N probably damaging Het
Htra3 A G 5: 35,668,316 V198A probably damaging Het
Katnal1 T C 5: 148,891,737 T300A probably benign Het
Lipo5 G T 19: 33,467,770 P133Q Het
Lrp1b A T 2: 41,770,846 H197Q Het
Mdc1 C A 17: 35,845,947 A82D probably damaging Het
Mstn A T 1: 53,064,249 D248V probably benign Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Ola1 G A 2: 73,141,964 T221I probably damaging Het
Olfr1086 T C 2: 86,676,892 Y147C possibly damaging Het
Olfr67 A G 7: 103,787,386 I297T probably damaging Het
Olfr857 T A 9: 19,713,132 S102T probably benign Het
Olfr898 T A 9: 38,349,970 Y290N probably damaging Het
Phldb1 T C 9: 44,711,904 T618A possibly damaging Het
Pkd1 T G 17: 24,591,119 W3565G probably damaging Het
Prl3a1 A T 13: 27,276,103 N190I probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn11 C T 5: 121,143,570 R484Q probably benign Het
Rapgef4 T C 2: 72,241,476 M900T probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Smarcd3 G T 5: 24,594,962 A270D probably damaging Het
Srgap2 A G 1: 131,344,449 M33T Het
Tle1 G C 4: 72,158,375 P139A probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Zfp658 T A 7: 43,573,989 S563T probably benign Het
Zswim9 G A 7: 13,259,752 R826C probably damaging Het
Other mutations in Bok
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02590:Bok APN 1 93686675 splice site probably benign
R0135:Bok UTSW 1 93686507 missense probably damaging 1.00
R0153:Bok UTSW 1 93686517 missense probably damaging 1.00
R0464:Bok UTSW 1 93694213 missense probably damaging 1.00
R0485:Bok UTSW 1 93689277 missense probably damaging 1.00
R0883:Bok UTSW 1 93686487 missense probably benign 0.44
R2177:Bok UTSW 1 93695065 nonsense probably null
R4612:Bok UTSW 1 93694178 missense probably damaging 1.00
R4789:Bok UTSW 1 93689241 missense probably damaging 0.98
R7686:Bok UTSW 1 93695100 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATTTGTTCATGGGGCCAAGG -3'
(R):5'- CAGCAGTGACTTTGGAACCC -3'

Sequencing Primer
(F):5'- CCAAGGTTGGGATAGTCAAATG -3'
(R):5'- CAGTGACTTTGGAACCCATAGG -3'
Posted On2019-05-15