Mutagenetix > Incidental Mutations

Incidental Mutation 'R7077:Bok'

549254

Institutional Source

Beutler Lab

Gene Symbol

Bok

Ensembl Gene

ENSMUSG00000026278

Gene Name

BCL2-related ovarian killer

Synonyms

mtd, matador

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7077 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

93685660-93695764 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 93689189 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 86 (Y86N)

Ref Sequence

ENSEMBL: ENSMUSP00000027499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027499] [ENSMUST00000188394] [ENSMUST00000201863]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027499
AA Change: Y86N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027499
Gene: ENSMUSG00000026278
AA Change: Y86N

Domain	Start	End	E-Value	Type
BCL	71	172	6.99e-37	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000188394
AA Change: Y86N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140412
Gene: ENSMUSG00000026278
AA Change: Y86N

Domain	Start	End	E-Value	Type
Pfam:Bcl-2	71	121	8.3e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000200888

Predicted Effect

probably damaging
Transcript: ENSMUST00000201863
AA Change: Y86N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144347
Gene: ENSMUSG00000026278
AA Change: Y86N

Domain	Start	End	E-Value	Type
BCL	71	172	6.99e-37	SMART

Meta Mutation Damage Score

0.9479

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the BCL2 family, members of which form homo- or heterodimers, and act as anti- or proapoptotic regulators that are involved in a wide variety of cellular processes. Studies in rat show that this protein has restricted expression in reproductive tissues, interacts strongly with some antiapoptotic BCL2 proteins, not at all with proapoptotic BCL2 proteins, and induces apoptosis in transfected cells. Thus, this protein represents a proapoptotic member of the BCL2 family. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit minor increase in spleen and thymus weight in female, but not male, mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam21	C	T	12: 81,559,119	C623Y	probably damaging	Het
Ago3	T	C	4: 126,371,532	K322R	probably null	Het
Ankrd17	T	C	5: 90,285,864	H682R	possibly damaging	Het
Aoah	A	G	13: 20,910,106	D187G	probably damaging	Het
Arhgap17	T	C	7: 123,280,008	D840G	unknown	Het
AW551984	C	T	9: 39,591,427	V650I	probably benign	Het
BC051142	C	A	17: 34,440,882	T93N	possibly damaging	Het
Ccdc146	T	A	5: 21,305,274	N580I	possibly damaging	Het
Ccng2	T	C	5: 93,269,340	S72P	possibly damaging	Het
Cfap74	T	G	4: 155,455,677	I977S	unknown	Het
Cobl	T	C	11: 12,253,441	N1087S	probably benign	Het
Cyp21a1	C	A	17: 34,802,359	R346L	probably damaging	Het
Eif4a1	A	C	11: 69,670,664	F52L	probably damaging	Het
Eif4ebp2	A	C	10: 61,433,801	I120S	probably damaging	Het
Enpp2	A	C	15: 54,901,391	D146E	probably benign	Het
Exosc9	T	C	3: 36,553,056	Y30H	probably damaging	Het
Fam117a	G	A	11: 95,377,672	G300S	probably benign	Het
Focad	C	A	4: 88,410,677	A1709E	unknown	Het
Fsd1	G	A	17: 55,993,876	R245H	probably damaging	Het
Fsip2	T	C	2: 82,983,152	F3272L	probably benign	Het
Gcnt2	G	A	13: 40,860,420	M22I	probably benign	Het
Gjd4	T	C	18: 9,280,928	E50G	probably damaging	Het
Gm10375	G	T	14: 43,602,970	T162K	probably benign	Het
Gm10837	C	G	14: 122,490,730	A6G	unknown	Het
Gm4924	T	C	10: 82,379,223	F952L	unknown	Het
Heatr1	T	C	13: 12,418,164	F1132L	possibly damaging	Het
Hnrnpu	A	G	1: 178,332,191	Y442H	unknown	Het
Hp1bp3	C	A	4: 138,239,618	T408N	probably damaging	Het
Htra3	A	G	5: 35,668,316	V198A	probably damaging	Het
Katnal1	T	C	5: 148,891,737	T300A	probably benign	Het
Lipo5	G	T	19: 33,467,770	P133Q		Het
Lrp1b	A	T	2: 41,770,846	H197Q		Het
Mdc1	C	A	17: 35,845,947	A82D	probably damaging	Het
Mstn	A	T	1: 53,064,249	D248V	probably benign	Het
Myo1d	C	T	11: 80,674,634	E426K	probably damaging	Het
Ola1	G	A	2: 73,141,964	T221I	probably damaging	Het
Olfr1086	T	C	2: 86,676,892	Y147C	possibly damaging	Het
Olfr67	A	G	7: 103,787,386	I297T	probably damaging	Het
Olfr857	T	A	9: 19,713,132	S102T	probably benign	Het
Olfr898	T	A	9: 38,349,970	Y290N	probably damaging	Het
Phldb1	T	C	9: 44,711,904	T618A	possibly damaging	Het
Pkd1	T	G	17: 24,591,119	W3565G	probably damaging	Het
Prl3a1	A	T	13: 27,276,103	N190I	probably benign	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Ptpn11	C	T	5: 121,143,570	R484Q	probably benign	Het
Rapgef4	T	C	2: 72,241,476	M900T	probably damaging	Het
Slc1a2	A	T	2: 102,777,510	D501V	probably benign	Het
Smarcd3	G	T	5: 24,594,962	A270D	probably damaging	Het
Srgap2	A	G	1: 131,344,449	M33T		Het
Tle1	G	C	4: 72,158,375	P139A	probably benign	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Zfp658	T	A	7: 43,573,989	S563T	probably benign	Het
Zswim9	G	A	7: 13,259,752	R826C	probably damaging	Het

Other mutations in Bok

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02590:Bok	APN	1	93686675	splice site	probably benign
R0135:Bok	UTSW	1	93686507	missense	probably damaging	1.00
R0153:Bok	UTSW	1	93686517	missense	probably damaging	1.00
R0464:Bok	UTSW	1	93694213	missense	probably damaging	1.00
R0485:Bok	UTSW	1	93689277	missense	probably damaging	1.00
R0883:Bok	UTSW	1	93686487	missense	probably benign	0.44
R2177:Bok	UTSW	1	93695065	nonsense	probably null
R4612:Bok	UTSW	1	93694178	missense	probably damaging	1.00
R4789:Bok	UTSW	1	93689241	missense	probably damaging	0.98
R7686:Bok	UTSW	1	93695100	missense	probably benign
Z1176:Bok	UTSW	1	93694045	critical splice acceptor site	probably benign

Predicted Primers

PCR Primer
(F):5'- ATTTGTTCATGGGGCCAAGG -3'
(R):5'- CAGCAGTGACTTTGGAACCC -3'

Sequencing Primer
(F):5'- CCAAGGTTGGGATAGTCAAATG -3'
(R):5'- CAGTGACTTTGGAACCCATAGG -3'

Posted On

2019-05-15