Mutagenetix > Incidental Mutations

Incidental Mutation 'R7077:Srgap2'

549255

Institutional Source

Beutler Lab

Gene Symbol

Srgap2

Ensembl Gene

ENSMUSG00000026425

Gene Name

SLIT-ROBO Rho GTPase activating protein 2

Synonyms

FBP2, Fnbp2, 9930124L22Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7077 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

131285251-131527352 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 131344449 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 33 (M33T)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097588] [ENSMUST00000185596] [ENSMUST00000186543]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097588
AA Change: M419T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000095195
Gene: ENSMUSG00000026425
AA Change: M419T

Domain	Start	End	E-Value	Type
FCH	22	120	7.33e-18	SMART
low complexity region	178	191	N/A	INTRINSIC
coiled coil region	363	401	N/A	INTRINSIC
Blast:RhoGAP	445	490	7e-12	BLAST
RhoGAP	502	676	9.6e-60	SMART
SH3	731	786	4.52e-15	SMART
low complexity region	852	868	N/A	INTRINSIC
coiled coil region	940	967	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000185596
AA Change: M278T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000141140
Gene: ENSMUSG00000026425
AA Change: M278T

Domain	Start	End	E-Value	Type
low complexity region	37	50	N/A	INTRINSIC
coiled coil region	222	260	N/A	INTRINSIC
Blast:RhoGAP	304	349	5e-12	BLAST
RhoGAP	361	535	5.9e-62	SMART
SH3	590	645	2.8e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000186543
AA Change: M419T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000139405
Gene: ENSMUSG00000026425
AA Change: M419T

Domain	Start	End	E-Value	Type
FCH	22	120	3.7e-20	SMART
low complexity region	178	191	N/A	INTRINSIC
coiled coil region	363	401	N/A	INTRINSIC
Blast:RhoGAP	445	490	7e-12	BLAST
RhoGAP	502	676	5.9e-62	SMART
SH3	731	786	2.8e-17	SMART

Predicted Effect

Meta Mutation Damage Score

0.0584

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the SLIT-ROBO Rho GTPase activating protein family. The encoded protein stimulates GTPase activity of Rac1, and plays a role in cortical neuron development. This locus has several paralogs on human chromosome 1 resulting from segmental duplication. While this locus itself is conserved among various species, the paralogs are found only in the genus Homo, and not in the genomes of non-human great apes. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele are born at below the expected Mendelian ratio, but are otherwise viable. Layer 5 cortical pyramidal neurons exhibit an increased density of dendritic spines with a decreased spine head width and increased length of spine necks. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam21	C	T	12: 81,559,119	C623Y	probably damaging	Het
Ago3	T	C	4: 126,371,532	K322R	probably null	Het
Ankrd17	T	C	5: 90,285,864	H682R	possibly damaging	Het
Aoah	A	G	13: 20,910,106	D187G	probably damaging	Het
Arhgap17	T	C	7: 123,280,008	D840G	unknown	Het
AW551984	C	T	9: 39,591,427	V650I	probably benign	Het
BC051142	C	A	17: 34,440,882	T93N	possibly damaging	Het
Bok	T	A	1: 93,689,189	Y86N	probably damaging	Het
Ccdc146	T	A	5: 21,305,274	N580I	possibly damaging	Het
Ccng2	T	C	5: 93,269,340	S72P	possibly damaging	Het
Cfap74	T	G	4: 155,455,677	I977S	unknown	Het
Cobl	T	C	11: 12,253,441	N1087S	probably benign	Het
Cyp21a1	C	A	17: 34,802,359	R346L	probably damaging	Het
Eif4a1	A	C	11: 69,670,664	F52L	probably damaging	Het
Eif4ebp2	A	C	10: 61,433,801	I120S	probably damaging	Het
Enpp2	A	C	15: 54,901,391	D146E	probably benign	Het
Exosc9	T	C	3: 36,553,056	Y30H	probably damaging	Het
Fam117a	G	A	11: 95,377,672	G300S	probably benign	Het
Focad	C	A	4: 88,410,677	A1709E	unknown	Het
Fsd1	G	A	17: 55,993,876	R245H	probably damaging	Het
Fsip2	T	C	2: 82,983,152	F3272L	probably benign	Het
Gcnt2	G	A	13: 40,860,420	M22I	probably benign	Het
Gjd4	T	C	18: 9,280,928	E50G	probably damaging	Het
Gm10375	G	T	14: 43,602,970	T162K	probably benign	Het
Gm10837	C	G	14: 122,490,730	A6G	unknown	Het
Gm4924	T	C	10: 82,379,223	F952L	unknown	Het
Heatr1	T	C	13: 12,418,164	F1132L	possibly damaging	Het
Hnrnpu	A	G	1: 178,332,191	Y442H	unknown	Het
Hp1bp3	C	A	4: 138,239,618	T408N	probably damaging	Het
Htra3	A	G	5: 35,668,316	V198A	probably damaging	Het
Katnal1	T	C	5: 148,891,737	T300A	probably benign	Het
Lipo5	G	T	19: 33,467,770	P133Q		Het
Lrp1b	A	T	2: 41,770,846	H197Q		Het
Mdc1	C	A	17: 35,845,947	A82D	probably damaging	Het
Mstn	A	T	1: 53,064,249	D248V	probably benign	Het
Myo1d	C	T	11: 80,674,634	E426K	probably damaging	Het
Ola1	G	A	2: 73,141,964	T221I	probably damaging	Het
Olfr1086	T	C	2: 86,676,892	Y147C	possibly damaging	Het
Olfr67	A	G	7: 103,787,386	I297T	probably damaging	Het
Olfr857	T	A	9: 19,713,132	S102T	probably benign	Het
Olfr898	T	A	9: 38,349,970	Y290N	probably damaging	Het
Phldb1	T	C	9: 44,711,904	T618A	possibly damaging	Het
Pkd1	T	G	17: 24,591,119	W3565G	probably damaging	Het
Prl3a1	A	T	13: 27,276,103	N190I	probably benign	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Ptpn11	C	T	5: 121,143,570	R484Q	probably benign	Het
Rapgef4	T	C	2: 72,241,476	M900T	probably damaging	Het
Slc1a2	A	T	2: 102,777,510	D501V	probably benign	Het
Smarcd3	G	T	5: 24,594,962	A270D	probably damaging	Het
Tle1	G	C	4: 72,158,375	P139A	probably benign	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Zfp658	T	A	7: 43,573,989	S563T	probably benign	Het
Zswim9	G	A	7: 13,259,752	R826C	probably damaging	Het

Other mutations in Srgap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00677:Srgap2	APN	1	131356700	missense	possibly damaging	0.89
IGL01738:Srgap2	APN	1	131296426	missense	probably benign	0.00
IGL01933:Srgap2	APN	1	131411855	missense	probably damaging	1.00
IGL01964:Srgap2	APN	1	131289578	missense	probably benign	0.08
IGL02028:Srgap2	APN	1	131296435	missense	probably damaging	0.98
IGL02159:Srgap2	APN	1	131319666	splice site	probably benign
IGL02326:Srgap2	APN	1	131356907	critical splice acceptor site	probably null
IGL02396:Srgap2	APN	1	131292675	missense	probably damaging	0.99
IGL02407:Srgap2	APN	1	131319602	missense	probably damaging	1.00
IGL02444:Srgap2	APN	1	131325153	splice site	probably null
IGL02559:Srgap2	APN	1	131524936	critical splice donor site	probably null
IGL02900:Srgap2	APN	1	131411796	splice site	probably benign
IGL03150:Srgap2	APN	1	131310600	missense	probably damaging	1.00
R0008:Srgap2	UTSW	1	131355564	missense	probably damaging	0.99
R0008:Srgap2	UTSW	1	131355564	missense	probably damaging	0.99
R0016:Srgap2	UTSW	1	131349462	missense	possibly damaging	0.95
R0016:Srgap2	UTSW	1	131349462	missense	possibly damaging	0.95
R0044:Srgap2	UTSW	1	131319551	missense	possibly damaging	0.68
R0441:Srgap2	UTSW	1	131336437	missense	probably damaging	1.00
R0580:Srgap2	UTSW	1	131349501	missense	possibly damaging	0.81
R0882:Srgap2	UTSW	1	131289515	missense	probably benign	0.00
R1412:Srgap2	UTSW	1	131300413	missense	possibly damaging	0.81
R1501:Srgap2	UTSW	1	131292699	missense	probably damaging	1.00
R1740:Srgap2	UTSW	1	131289388	missense	probably benign	0.00
R1764:Srgap2	UTSW	1	131319537	missense	possibly damaging	0.94
R1772:Srgap2	UTSW	1	131319638	missense	probably damaging	0.99
R1776:Srgap2	UTSW	1	131411850	missense	probably damaging	1.00
R2393:Srgap2	UTSW	1	131332134	missense	probably benign	0.00
R3011:Srgap2	UTSW	1	131310591	missense	probably damaging	0.99
R3149:Srgap2	UTSW	1	131292589	missense	probably benign	0.00
R3150:Srgap2	UTSW	1	131292589	missense	probably benign	0.00
R3800:Srgap2	UTSW	1	131310559	missense	probably damaging	1.00
R4871:Srgap2	UTSW	1	131289472	missense	probably benign	0.00
R4884:Srgap2	UTSW	1	131292576	splice site	probably null
R5454:Srgap2	UTSW	1	131289737	missense	probably benign	0.08
R5536:Srgap2	UTSW	1	131300390	splice site	probably null
R6113:Srgap2	UTSW	1	131355505	splice site	probably null
R6174:Srgap2	UTSW	1	131289616	missense	probably benign	0.00
R6180:Srgap2	UTSW	1	131349541	missense	probably benign	0.00
R6341:Srgap2	UTSW	1	131291629	missense	probably benign	0.02
R6357:Srgap2	UTSW	1	131355542	missense	probably damaging	1.00
R6363:Srgap2	UTSW	1	131298468	missense	probably damaging	1.00
R6770:Srgap2	UTSW	1	131298510	missense	probably benign	0.00
R6934:Srgap2	UTSW	1	131317231	missense	possibly damaging	0.81
R7007:Srgap2	UTSW	1	131319537	missense	probably benign	0.15
R7147:Srgap2	UTSW	1	131310594	missense
R7326:Srgap2	UTSW	1	131291613	nonsense	probably null
R7467:Srgap2	UTSW	1	131292667	missense	probably damaging	0.97
R7500:Srgap2	UTSW	1	131436831	missense	probably damaging	1.00
R7579:Srgap2	UTSW	1	131292633	missense	probably damaging	0.99
R7923:Srgap2	UTSW	1	131300413	missense	possibly damaging	0.81
R7989:Srgap2	UTSW	1	131298432	missense
R8283:Srgap2	UTSW	1	131364033	missense	probably damaging	0.99
X0022:Srgap2	UTSW	1	131411949	missense	probably benign	0.01
Z1177:Srgap2	UTSW	1	131355510	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTTGATTCCAAAGCTCCTGTGG -3'
(R):5'- GTGATCTGCTGGCATCCTTC -3'

Sequencing Primer
(F):5'- AAAGCTCCTGTGGGCGTCAG -3'
(R):5'- TCTTGGGAAGAGAGACATTCCTCC -3'

Posted On

2019-05-15