Incidental Mutation 'R7077:Srgap2'
ID549255
Institutional Source Beutler Lab
Gene Symbol Srgap2
Ensembl Gene ENSMUSG00000026425
Gene NameSLIT-ROBO Rho GTPase activating protein 2
SynonymsFBP2, Fnbp2, 9930124L22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7077 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location131285251-131527352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131344449 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 33 (M33T)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097588] [ENSMUST00000185596] [ENSMUST00000186543]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097588
AA Change: M419T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095195
Gene: ENSMUSG00000026425
AA Change: M419T

DomainStartEndE-ValueType
FCH 22 120 7.33e-18 SMART
low complexity region 178 191 N/A INTRINSIC
coiled coil region 363 401 N/A INTRINSIC
Blast:RhoGAP 445 490 7e-12 BLAST
RhoGAP 502 676 9.6e-60 SMART
SH3 731 786 4.52e-15 SMART
low complexity region 852 868 N/A INTRINSIC
coiled coil region 940 967 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185596
AA Change: M278T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141140
Gene: ENSMUSG00000026425
AA Change: M278T

DomainStartEndE-ValueType
low complexity region 37 50 N/A INTRINSIC
coiled coil region 222 260 N/A INTRINSIC
Blast:RhoGAP 304 349 5e-12 BLAST
RhoGAP 361 535 5.9e-62 SMART
SH3 590 645 2.8e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186543
AA Change: M419T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000139405
Gene: ENSMUSG00000026425
AA Change: M419T

DomainStartEndE-ValueType
FCH 22 120 3.7e-20 SMART
low complexity region 178 191 N/A INTRINSIC
coiled coil region 363 401 N/A INTRINSIC
Blast:RhoGAP 445 490 7e-12 BLAST
RhoGAP 502 676 5.9e-62 SMART
SH3 731 786 2.8e-17 SMART
Predicted Effect
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the SLIT-ROBO Rho GTPase activating protein family. The encoded protein stimulates GTPase activity of Rac1, and plays a role in cortical neuron development. This locus has several paralogs on human chromosome 1 resulting from segmental duplication. While this locus itself is conserved among various species, the paralogs are found only in the genus Homo, and not in the genomes of non-human great apes. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele are born at below the expected Mendelian ratio, but are otherwise viable. Layer 5 cortical pyramidal neurons exhibit an increased density of dendritic spines with a decreased spine head width and increased length of spine necks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 C T 12: 81,559,119 C623Y probably damaging Het
Ago3 T C 4: 126,371,532 K322R probably null Het
Ankrd17 T C 5: 90,285,864 H682R possibly damaging Het
Aoah A G 13: 20,910,106 D187G probably damaging Het
Arhgap17 T C 7: 123,280,008 D840G unknown Het
AW551984 C T 9: 39,591,427 V650I probably benign Het
BC051142 C A 17: 34,440,882 T93N possibly damaging Het
Bok T A 1: 93,689,189 Y86N probably damaging Het
Ccdc146 T A 5: 21,305,274 N580I possibly damaging Het
Ccng2 T C 5: 93,269,340 S72P possibly damaging Het
Cfap74 T G 4: 155,455,677 I977S unknown Het
Cobl T C 11: 12,253,441 N1087S probably benign Het
Cyp21a1 C A 17: 34,802,359 R346L probably damaging Het
Eif4a1 A C 11: 69,670,664 F52L probably damaging Het
Eif4ebp2 A C 10: 61,433,801 I120S probably damaging Het
Enpp2 A C 15: 54,901,391 D146E probably benign Het
Exosc9 T C 3: 36,553,056 Y30H probably damaging Het
Fam117a G A 11: 95,377,672 G300S probably benign Het
Focad C A 4: 88,410,677 A1709E unknown Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Fsip2 T C 2: 82,983,152 F3272L probably benign Het
Gcnt2 G A 13: 40,860,420 M22I probably benign Het
Gjd4 T C 18: 9,280,928 E50G probably damaging Het
Gm10375 G T 14: 43,602,970 T162K probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gm4924 T C 10: 82,379,223 F952L unknown Het
Heatr1 T C 13: 12,418,164 F1132L possibly damaging Het
Hnrnpu A G 1: 178,332,191 Y442H unknown Het
Hp1bp3 C A 4: 138,239,618 T408N probably damaging Het
Htra3 A G 5: 35,668,316 V198A probably damaging Het
Katnal1 T C 5: 148,891,737 T300A probably benign Het
Lipo5 G T 19: 33,467,770 P133Q Het
Lrp1b A T 2: 41,770,846 H197Q Het
Mdc1 C A 17: 35,845,947 A82D probably damaging Het
Mstn A T 1: 53,064,249 D248V probably benign Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Ola1 G A 2: 73,141,964 T221I probably damaging Het
Olfr1086 T C 2: 86,676,892 Y147C possibly damaging Het
Olfr67 A G 7: 103,787,386 I297T probably damaging Het
Olfr857 T A 9: 19,713,132 S102T probably benign Het
Olfr898 T A 9: 38,349,970 Y290N probably damaging Het
Phldb1 T C 9: 44,711,904 T618A possibly damaging Het
Pkd1 T G 17: 24,591,119 W3565G probably damaging Het
Prl3a1 A T 13: 27,276,103 N190I probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn11 C T 5: 121,143,570 R484Q probably benign Het
Rapgef4 T C 2: 72,241,476 M900T probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Smarcd3 G T 5: 24,594,962 A270D probably damaging Het
Tle1 G C 4: 72,158,375 P139A probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Zfp658 T A 7: 43,573,989 S563T probably benign Het
Zswim9 G A 7: 13,259,752 R826C probably damaging Het
Other mutations in Srgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00677:Srgap2 APN 1 131356700 missense possibly damaging 0.89
IGL01738:Srgap2 APN 1 131296426 missense probably benign 0.00
IGL01933:Srgap2 APN 1 131411855 missense probably damaging 1.00
IGL01964:Srgap2 APN 1 131289578 missense probably benign 0.08
IGL02028:Srgap2 APN 1 131296435 missense probably damaging 0.98
IGL02159:Srgap2 APN 1 131319666 splice site probably benign
IGL02326:Srgap2 APN 1 131356907 critical splice acceptor site probably null
IGL02396:Srgap2 APN 1 131292675 missense probably damaging 0.99
IGL02407:Srgap2 APN 1 131319602 missense probably damaging 1.00
IGL02444:Srgap2 APN 1 131325153 splice site probably null
IGL02559:Srgap2 APN 1 131524936 critical splice donor site probably null
IGL02900:Srgap2 APN 1 131411796 splice site probably benign
IGL03150:Srgap2 APN 1 131310600 missense probably damaging 1.00
R0008:Srgap2 UTSW 1 131355564 missense probably damaging 0.99
R0008:Srgap2 UTSW 1 131355564 missense probably damaging 0.99
R0016:Srgap2 UTSW 1 131349462 missense possibly damaging 0.95
R0016:Srgap2 UTSW 1 131349462 missense possibly damaging 0.95
R0044:Srgap2 UTSW 1 131319551 missense possibly damaging 0.68
R0441:Srgap2 UTSW 1 131336437 missense probably damaging 1.00
R0580:Srgap2 UTSW 1 131349501 missense possibly damaging 0.81
R0882:Srgap2 UTSW 1 131289515 missense probably benign 0.00
R1412:Srgap2 UTSW 1 131300413 missense possibly damaging 0.81
R1501:Srgap2 UTSW 1 131292699 missense probably damaging 1.00
R1740:Srgap2 UTSW 1 131289388 missense probably benign 0.00
R1764:Srgap2 UTSW 1 131319537 missense possibly damaging 0.94
R1772:Srgap2 UTSW 1 131319638 missense probably damaging 0.99
R1776:Srgap2 UTSW 1 131411850 missense probably damaging 1.00
R2393:Srgap2 UTSW 1 131332134 missense probably benign 0.00
R3011:Srgap2 UTSW 1 131310591 missense probably damaging 0.99
R3149:Srgap2 UTSW 1 131292589 missense probably benign 0.00
R3150:Srgap2 UTSW 1 131292589 missense probably benign 0.00
R3800:Srgap2 UTSW 1 131310559 missense probably damaging 1.00
R4871:Srgap2 UTSW 1 131289472 missense probably benign 0.00
R4884:Srgap2 UTSW 1 131292576 unclassified probably null
R5454:Srgap2 UTSW 1 131289737 missense probably benign 0.08
R5536:Srgap2 UTSW 1 131300390 splice site probably null
R6113:Srgap2 UTSW 1 131355505 splice site probably null
R6174:Srgap2 UTSW 1 131289616 missense probably benign 0.00
R6180:Srgap2 UTSW 1 131349541 missense probably benign 0.00
R6341:Srgap2 UTSW 1 131291629 missense probably benign 0.02
R6357:Srgap2 UTSW 1 131355542 missense probably damaging 1.00
R6363:Srgap2 UTSW 1 131298468 missense probably damaging 1.00
R6770:Srgap2 UTSW 1 131298510 missense probably benign 0.00
R6934:Srgap2 UTSW 1 131317231 missense possibly damaging 0.81
R7007:Srgap2 UTSW 1 131319537 missense probably benign 0.15
R7147:Srgap2 UTSW 1 131310594 missense
R7326:Srgap2 UTSW 1 131291613 nonsense probably null
R7467:Srgap2 UTSW 1 131292667 missense probably damaging 0.97
R7500:Srgap2 UTSW 1 131436831 missense probably damaging 1.00
R7579:Srgap2 UTSW 1 131292633 missense probably damaging 0.99
X0022:Srgap2 UTSW 1 131411949 missense probably benign 0.01
Z1177:Srgap2 UTSW 1 131355510 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTGATTCCAAAGCTCCTGTGG -3'
(R):5'- GTGATCTGCTGGCATCCTTC -3'

Sequencing Primer
(F):5'- AAAGCTCCTGTGGGCGTCAG -3'
(R):5'- TCTTGGGAAGAGAGACATTCCTCC -3'
Posted On2019-05-15