Mutagenetix > Incidental Mutations

Incidental Mutation 'R7077:Rapgef4'

549258

Institutional Source

Beutler Lab

Gene Symbol

Rapgef4

Ensembl Gene

ENSMUSG00000049044

Gene Name

Rap guanine nucleotide exchange factor (GEF) 4

Synonyms

cAMP-GEFII, Epac2, 1300003D15Rik, 5730402K07Rik, 6330581N18Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.584) question?

Stock #

R7077 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71981240-72257474 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 72241476 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 900 (M900T)

Ref Sequence

ENSEMBL: ENSMUSP00000088336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028525] [ENSMUST00000090826] [ENSMUST00000102698]

PDB Structure

CRYSTAL STRUCTURE OF THE REGULATORY DOMAIN OF EPAC2 [X-RAY DIFFRACTION]
STRUCTURE OF THE CAMP RESPONSIVE EXCHANGE FACTOR EPAC2 IN ITS AUTO-INHIBITED STATE [X-RAY DIFFRACTION]
Structure of Epac2 in complex with cyclic-AMP and Rap [X-RAY DIFFRACTION]
Conformational dynamics of exchange protein directly activated by cAMP [X-RAY DIFFRACTION]
Selective activation of Epac1 and Epac2 [X-RAY DIFFRACTION]
Selective activation of Epac1 and Epac2 [X-RAY DIFFRACTION]
Selective activation of Epac1 and Epac2 [X-RAY DIFFRACTION]
Selective activation of Epac1 and Epac2 [X-RAY DIFFRACTION]
Selective activation of Epac1 and Epac2 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028525
AA Change: M756T

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000028525
Gene: ENSMUSG00000049044
AA Change: M756T

Domain	Start	End	E-Value	Type
DEP	72	147	3.43e-27	SMART
low complexity region	158	167	N/A	INTRINSIC
cNMP	212	331	4.02e-15	SMART
RasGEFN	351	486	3.61e-7	SMART
Blast:RasGEF	534	607	1e-33	BLAST
RasGEF	624	866	8.09e-105	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000090826
AA Change: M900T

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000088336
Gene: ENSMUSG00000049044
AA Change: M900T

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
cNMP	43	162	4.62e-15	SMART
DEP	216	291	3.43e-27	SMART
low complexity region	302	311	N/A	INTRINSIC
cNMP	356	475	4.02e-15	SMART
RasGEFN	495	630	3.61e-7	SMART
Blast:RasGEF	678	751	2e-33	BLAST
RasGEF	768	1010	8.09e-105	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102698
AA Change: M882T

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000099759
Gene: ENSMUSG00000049044
AA Change: M882T

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
cNMP	43	162	4.62e-15	SMART
DEP	198	273	3.43e-27	SMART
low complexity region	284	293	N/A	INTRINSIC
cNMP	338	457	4.02e-15	SMART
RasGEFN	477	612	3.61e-7	SMART
Blast:RasGEF	660	733	2e-33	BLAST
RasGEF	750	992	8.09e-105	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (54/55)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin granule fusion in pancreatic islet cells during the first phase of cAMP-dependent insulin granule exocytosis. Mice homozygous for a knock-out allele exhibit impaired isoproterenol-induced SR calcium leak and arrhythmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam21	C	T	12: 81,559,119	C623Y	probably damaging	Het
Ago3	T	C	4: 126,371,532	K322R	probably null	Het
Ankrd17	T	C	5: 90,285,864	H682R	possibly damaging	Het
Aoah	A	G	13: 20,910,106	D187G	probably damaging	Het
Arhgap17	T	C	7: 123,280,008	D840G	unknown	Het
AW551984	C	T	9: 39,591,427	V650I	probably benign	Het
BC051142	C	A	17: 34,440,882	T93N	possibly damaging	Het
Bok	T	A	1: 93,689,189	Y86N	probably damaging	Het
Ccdc146	T	A	5: 21,305,274	N580I	possibly damaging	Het
Ccng2	T	C	5: 93,269,340	S72P	possibly damaging	Het
Cfap74	T	G	4: 155,455,677	I977S	unknown	Het
Cobl	T	C	11: 12,253,441	N1087S	probably benign	Het
Cyp21a1	C	A	17: 34,802,359	R346L	probably damaging	Het
Eif4a1	A	C	11: 69,670,664	F52L	probably damaging	Het
Eif4ebp2	A	C	10: 61,433,801	I120S	probably damaging	Het
Enpp2	A	C	15: 54,901,391	D146E	probably benign	Het
Exosc9	T	C	3: 36,553,056	Y30H	probably damaging	Het
Fam117a	G	A	11: 95,377,672	G300S	probably benign	Het
Focad	C	A	4: 88,410,677	A1709E	unknown	Het
Fsd1	G	A	17: 55,993,876	R245H	probably damaging	Het
Fsip2	T	C	2: 82,983,152	F3272L	probably benign	Het
Gcnt2	G	A	13: 40,860,420	M22I	probably benign	Het
Gjd4	T	C	18: 9,280,928	E50G	probably damaging	Het
Gm10375	G	T	14: 43,602,970	T162K	probably benign	Het
Gm10837	C	G	14: 122,490,730	A6G	unknown	Het
Gm4924	T	C	10: 82,379,223	F952L	unknown	Het
Heatr1	T	C	13: 12,418,164	F1132L	possibly damaging	Het
Hnrnpu	A	G	1: 178,332,191	Y442H	unknown	Het
Hp1bp3	C	A	4: 138,239,618	T408N	probably damaging	Het
Htra3	A	G	5: 35,668,316	V198A	probably damaging	Het
Katnal1	T	C	5: 148,891,737	T300A	probably benign	Het
Lipo5	G	T	19: 33,467,770	P133Q		Het
Lrp1b	A	T	2: 41,770,846	H197Q		Het
Mdc1	C	A	17: 35,845,947	A82D	probably damaging	Het
Mstn	A	T	1: 53,064,249	D248V	probably benign	Het
Myo1d	C	T	11: 80,674,634	E426K	probably damaging	Het
Ola1	G	A	2: 73,141,964	T221I	probably damaging	Het
Olfr1086	T	C	2: 86,676,892	Y147C	possibly damaging	Het
Olfr67	A	G	7: 103,787,386	I297T	probably damaging	Het
Olfr857	T	A	9: 19,713,132	S102T	probably benign	Het
Olfr898	T	A	9: 38,349,970	Y290N	probably damaging	Het
Phldb1	T	C	9: 44,711,904	T618A	possibly damaging	Het
Pkd1	T	G	17: 24,591,119	W3565G	probably damaging	Het
Prl3a1	A	T	13: 27,276,103	N190I	probably benign	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Ptpn11	C	T	5: 121,143,570	R484Q	probably benign	Het
Slc1a2	A	T	2: 102,777,510	D501V	probably benign	Het
Smarcd3	G	T	5: 24,594,962	A270D	probably damaging	Het
Srgap2	A	G	1: 131,344,449	M33T		Het
Tle1	G	C	4: 72,158,375	P139A	probably benign	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Zfp658	T	A	7: 43,573,989	S563T	probably benign	Het
Zswim9	G	A	7: 13,259,752	R826C	probably damaging	Het

Other mutations in Rapgef4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Rapgef4	APN	2	72256312	missense	possibly damaging	0.75
IGL00858:Rapgef4	APN	2	72198897	missense	probably damaging	1.00
IGL01408:Rapgef4	APN	2	72174841	nonsense	probably null
IGL01673:Rapgef4	APN	2	72241437	missense	probably damaging	0.99
IGL01678:Rapgef4	APN	2	72242225	splice site	probably benign
IGL01725:Rapgef4	APN	2	72174874	missense	probably benign	0.24
IGL01871:Rapgef4	APN	2	72198360	missense	possibly damaging	0.69
IGL01935:Rapgef4	APN	2	72234123	missense	probably benign	0.05
IGL02001:Rapgef4	APN	2	72225052	splice site	probably benign
IGL02041:Rapgef4	APN	2	72198796	missense	probably damaging	1.00
IGL02134:Rapgef4	APN	2	72180061	missense	probably damaging	0.97
IGL02410:Rapgef4	APN	2	72226594	missense	possibly damaging	0.51
IGL02807:Rapgef4	APN	2	72205649	splice site	probably benign
IGL03066:Rapgef4	APN	2	72141179	splice site	probably benign
IGL03282:Rapgef4	APN	2	72205752	splice site	probably benign
IGL03291:Rapgef4	APN	2	72195703	missense	probably damaging	1.00
P0033:Rapgef4	UTSW	2	72137331	intron	probably benign
R0045:Rapgef4	UTSW	2	72198778	missense	possibly damaging	0.80
R0045:Rapgef4	UTSW	2	72198778	missense	possibly damaging	0.80
R0309:Rapgef4	UTSW	2	72226030	missense	probably benign	0.02
R0398:Rapgef4	UTSW	2	72031041	missense	probably damaging	0.99
R0747:Rapgef4	UTSW	2	72223073	missense	possibly damaging	0.66
R1216:Rapgef4	UTSW	2	72208148	missense	possibly damaging	0.51
R1264:Rapgef4	UTSW	2	72031105	missense	possibly damaging	0.48
R1302:Rapgef4	UTSW	2	72045160	missense	probably benign	0.31
R1460:Rapgef4	UTSW	2	72031176	critical splice donor site	probably null
R1483:Rapgef4	UTSW	2	72055026	critical splice donor site	probably null
R1682:Rapgef4	UTSW	2	72226568	missense	possibly damaging	0.80
R1768:Rapgef4	UTSW	2	72225787	splice site	probably benign
R1858:Rapgef4	UTSW	2	72031064	missense	possibly damaging	0.67
R1860:Rapgef4	UTSW	2	72234720	missense	probably benign	0.05
R1952:Rapgef4	UTSW	2	72208127	missense	probably benign	0.07
R2025:Rapgef4	UTSW	2	72242739	missense	probably benign	0.01
R2128:Rapgef4	UTSW	2	72226553	missense	possibly damaging	0.87
R2159:Rapgef4	UTSW	2	72174881	missense	probably damaging	1.00
R2201:Rapgef4	UTSW	2	72045189	missense	probably damaging	0.96
R2883:Rapgef4	UTSW	2	72031125	missense	probably benign
R3015:Rapgef4	UTSW	2	72198373	missense	probably damaging	1.00
R4278:Rapgef4	UTSW	2	72198395	missense	possibly damaging	0.95
R5256:Rapgef4	UTSW	2	72034034	missense	probably damaging	0.97
R5572:Rapgef4	UTSW	2	72034120	critical splice donor site	probably null
R5574:Rapgef4	UTSW	2	72034120	critical splice donor site	probably null
R5575:Rapgef4	UTSW	2	72034120	critical splice donor site	probably null
R5749:Rapgef4	UTSW	2	72242757	missense	probably damaging	1.00
R6007:Rapgef4	UTSW	2	72179949	missense	possibly damaging	0.55
R6084:Rapgef4	UTSW	2	72196278	critical splice donor site	probably null
R6192:Rapgef4	UTSW	2	71981317	missense	probably benign	0.00
R6409:Rapgef4	UTSW	2	72178237	missense	probably benign	0.01
R6683:Rapgef4	UTSW	2	72054779	intron	probably benign
R6774:Rapgef4	UTSW	2	72225775	missense	probably benign	0.01
R6844:Rapgef4	UTSW	2	72234626	missense	probably damaging	0.99
R6999:Rapgef4	UTSW	2	72239125	missense	probably damaging	1.00
R7138:Rapgef4	UTSW	2	72198363	missense	probably damaging	1.00
R7275:Rapgef4	UTSW	2	72208101	missense	probably damaging	1.00
R7352:Rapgef4	UTSW	2	72180091	missense	probably damaging	1.00
R7397:Rapgef4	UTSW	2	72205666	missense	probably benign	0.23
R7508:Rapgef4	UTSW	2	72205733	missense	probably benign	0.00
R7620:Rapgef4	UTSW	2	72229078	missense	probably damaging	0.99
R7703:Rapgef4	UTSW	2	72179971	missense	probably benign	0.28
R7770:Rapgef4	UTSW	2	72198395	missense	possibly damaging	0.95
R7814:Rapgef4	UTSW	2	72223117	missense	probably benign
R7868:Rapgef4	UTSW	2	72201137	missense	probably benign	0.11
R7951:Rapgef4	UTSW	2	72201137	missense	probably benign	0.11
X0062:Rapgef4	UTSW	2	72226607	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- CTTCCCCTGGATTGGCTATG -3'
(R):5'- GGGGCCATTCATTAGTCAGAC -3'

Sequencing Primer
(F):5'- CTTTAATCCTAGCACCTGGGAGG -3'
(R):5'- GGCCATTCATTAGTCAGACATGCTTG -3'

Posted On

2019-05-15