Incidental Mutation 'R7077:Cfap74'
ID549268
Institutional Source Beutler Lab
Gene Symbol Cfap74
Ensembl Gene ENSMUSG00000078490
Gene Namecilia and flagella associated protein 74
Synonyms2010015L04Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: isoform 1: NM_177674.5; isoform 2: NM_001166029.1; MGI: 1917130

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7077 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location155409190-155466823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 155455677 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 977 (I977S)
Ref Sequence ENSEMBL: ENSMUSP00000123626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105619] [ENSMUST00000151083]
Predicted Effect probably benign
Transcript: ENSMUST00000105619
Predicted Effect unknown
Transcript: ENSMUST00000151083
AA Change: I977S
SMART Domains Protein: ENSMUSP00000123626
Gene: ENSMUSG00000078490
AA Change: I977S

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
coiled coil region 134 162 N/A INTRINSIC
coiled coil region 333 378 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (54/55)
Allele List at MGI

All alleles(7) : Targeted(2) Gene trapped(5)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 C T 12: 81,559,119 C623Y probably damaging Het
Ago3 T C 4: 126,371,532 K322R probably null Het
Ankrd17 T C 5: 90,285,864 H682R possibly damaging Het
Aoah A G 13: 20,910,106 D187G probably damaging Het
Arhgap17 T C 7: 123,280,008 D840G unknown Het
AW551984 C T 9: 39,591,427 V650I probably benign Het
BC051142 C A 17: 34,440,882 T93N possibly damaging Het
Bok T A 1: 93,689,189 Y86N probably damaging Het
Ccdc146 T A 5: 21,305,274 N580I possibly damaging Het
Ccng2 T C 5: 93,269,340 S72P possibly damaging Het
Cobl T C 11: 12,253,441 N1087S probably benign Het
Cyp21a1 C A 17: 34,802,359 R346L probably damaging Het
Eif4a1 A C 11: 69,670,664 F52L probably damaging Het
Eif4ebp2 A C 10: 61,433,801 I120S probably damaging Het
Enpp2 A C 15: 54,901,391 D146E probably benign Het
Exosc9 T C 3: 36,553,056 Y30H probably damaging Het
Fam117a G A 11: 95,377,672 G300S probably benign Het
Focad C A 4: 88,410,677 A1709E unknown Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Fsip2 T C 2: 82,983,152 F3272L probably benign Het
Gcnt2 G A 13: 40,860,420 M22I probably benign Het
Gjd4 T C 18: 9,280,928 E50G probably damaging Het
Gm10375 G T 14: 43,602,970 T162K probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gm4924 T C 10: 82,379,223 F952L unknown Het
Heatr1 T C 13: 12,418,164 F1132L possibly damaging Het
Hnrnpu A G 1: 178,332,191 Y442H unknown Het
Hp1bp3 C A 4: 138,239,618 T408N probably damaging Het
Htra3 A G 5: 35,668,316 V198A probably damaging Het
Katnal1 T C 5: 148,891,737 T300A probably benign Het
Lipo5 G T 19: 33,467,770 P133Q Het
Lrp1b A T 2: 41,770,846 H197Q Het
Mdc1 C A 17: 35,845,947 A82D probably damaging Het
Mstn A T 1: 53,064,249 D248V probably benign Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Ola1 G A 2: 73,141,964 T221I probably damaging Het
Olfr1086 T C 2: 86,676,892 Y147C possibly damaging Het
Olfr67 A G 7: 103,787,386 I297T probably damaging Het
Olfr857 T A 9: 19,713,132 S102T probably benign Het
Olfr898 T A 9: 38,349,970 Y290N probably damaging Het
Phldb1 T C 9: 44,711,904 T618A possibly damaging Het
Pkd1 T G 17: 24,591,119 W3565G probably damaging Het
Prl3a1 A T 13: 27,276,103 N190I probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn11 C T 5: 121,143,570 R484Q probably benign Het
Rapgef4 T C 2: 72,241,476 M900T probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Smarcd3 G T 5: 24,594,962 A270D probably damaging Het
Srgap2 A G 1: 131,344,449 M33T Het
Tle1 G C 4: 72,158,375 P139A probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Zfp658 T A 7: 43,573,989 S563T probably benign Het
Zswim9 G A 7: 13,259,752 R826C probably damaging Het
Other mutations in Cfap74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01607:Cfap74 APN 4 155418986 missense possibly damaging 0.95
paranoid UTSW 4 155454024 utr 5 prime probably benign
sensibile UTSW 4 155441286 missense probably null 0.03
touchy UTSW 4 155463072 missense probably benign 0.27
FR4304:Cfap74 UTSW 4 155415760 missense possibly damaging 0.93
P0007:Cfap74 UTSW 4 155422228 missense possibly damaging 0.83
PIT4434001:Cfap74 UTSW 4 155463964 missense unknown
R0025:Cfap74 UTSW 4 155426115 missense probably benign 0.22
R0034:Cfap74 UTSW 4 155460887 splice site probably benign
R0193:Cfap74 UTSW 4 155426115 missense probably benign 0.22
R0306:Cfap74 UTSW 4 155465439 unclassified probably benign
R0427:Cfap74 UTSW 4 155441277 missense probably benign 0.02
R0905:Cfap74 UTSW 4 155418696 critical splice donor site probably null
R1116:Cfap74 UTSW 4 155433996 missense probably benign 0.15
R1548:Cfap74 UTSW 4 155434045 missense probably benign 0.45
R1950:Cfap74 UTSW 4 155427430 critical splice donor site probably null
R2009:Cfap74 UTSW 4 155420267 missense possibly damaging 0.77
R2029:Cfap74 UTSW 4 155442081 missense possibly damaging 0.74
R2135:Cfap74 UTSW 4 155429940 missense probably damaging 0.97
R2135:Cfap74 UTSW 4 155429951 missense probably damaging 1.00
R2154:Cfap74 UTSW 4 155429296 missense possibly damaging 0.94
R2413:Cfap74 UTSW 4 155418624 missense possibly damaging 0.76
R2418:Cfap74 UTSW 4 155455709 utr 5 prime probably benign
R2930:Cfap74 UTSW 4 155438170 missense probably damaging 0.97
R3965:Cfap74 UTSW 4 155446717 missense probably damaging 1.00
R4078:Cfap74 UTSW 4 155455671 missense probably damaging 0.98
R4238:Cfap74 UTSW 4 155463072 missense probably benign 0.27
R4239:Cfap74 UTSW 4 155463072 missense probably benign 0.27
R4240:Cfap74 UTSW 4 155463072 missense probably benign 0.27
R4491:Cfap74 UTSW 4 155429171 missense probably benign 0.22
R4731:Cfap74 UTSW 4 155463602 intron probably benign
R5333:Cfap74 UTSW 4 155436740 missense probably damaging 0.99
R5362:Cfap74 UTSW 4 155438166 missense probably damaging 0.98
R5425:Cfap74 UTSW 4 155455692 utr 5 prime probably benign
R5468:Cfap74 UTSW 4 155426041 missense probably benign 0.27
R5839:Cfap74 UTSW 4 155422750 critical splice donor site probably null
R6010:Cfap74 UTSW 4 155454038 missense possibly damaging 0.83
R6284:Cfap74 UTSW 4 155451796 missense probably damaging 0.96
R6323:Cfap74 UTSW 4 155463938 missense possibly damaging 0.54
R6389:Cfap74 UTSW 4 155423336 missense possibly damaging 0.69
R6513:Cfap74 UTSW 4 155441286 missense probably null 0.03
R6527:Cfap74 UTSW 4 155422265 unclassified probably null
R6785:Cfap74 UTSW 4 155454024 utr 5 prime probably benign
R6980:Cfap74 UTSW 4 155466352 unclassified probably benign
R7039:Cfap74 UTSW 4 155454108 critical splice donor site probably null
R7116:Cfap74 UTSW 4 155455061 missense unknown
R7202:Cfap74 UTSW 4 155426197 splice site probably null
R7227:Cfap74 UTSW 4 155460948 nonsense probably null
R7228:Cfap74 UTSW 4 155465050 missense unknown
R7261:Cfap74 UTSW 4 155465374 missense unknown
R7315:Cfap74 UTSW 4 155463019 missense unknown
R7337:Cfap74 UTSW 4 155460015 missense unknown
R7354:Cfap74 UTSW 4 155465347 missense unknown
R7533:Cfap74 UTSW 4 155415743 missense
R7673:Cfap74 UTSW 4 155463056 missense unknown
R7798:Cfap74 UTSW 4 155422622 missense
R7829:Cfap74 UTSW 4 155429237 missense
R7897:Cfap74 UTSW 4 155429894 missense
R7980:Cfap74 UTSW 4 155429894 missense
T0970:Cfap74 UTSW 4 155463117 splice site probably null
X0066:Cfap74 UTSW 4 155463964 missense probably damaging 1.00
Z1176:Cfap74 UTSW 4 155426118
Z1177:Cfap74 UTSW 4 155454913
Predicted Primers PCR Primer
(F):5'- TTGAGCACTCACTCACGCATG -3'
(R):5'- CTGTCTATTCCAGCCCTGAG -3'

Sequencing Primer
(F):5'- TCACGCATGCACACTCGTG -3'
(R):5'- TATTCCAGCCCTGAGGTCAG -3'
Posted On2019-05-15