Incidental Mutation 'R7077:Smarcd3'
ID549270
Institutional Source Beutler Lab
Gene Symbol Smarcd3
Ensembl Gene ENSMUSG00000028949
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3
SynonymsBAF60C, 1500001J14Rik, 2210409C08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7077 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location24590818-24624411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24594962 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 270 (A270D)
Ref Sequence ENSEMBL: ENSMUSP00000030791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030791] [ENSMUST00000088295] [ENSMUST00000121863] [ENSMUST00000195943] [ENSMUST00000197318]
Predicted Effect probably damaging
Transcript: ENSMUST00000030791
AA Change: A270D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030791
Gene: ENSMUSG00000028949
AA Change: A270D

DomainStartEndE-ValueType
low complexity region 40 55 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
Blast:KISc 103 239 5e-41 BLAST
SWIB 259 338 3.6e-29 SMART
Blast:MYSc 420 466 1e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000088295
SMART Domains Protein: ENSMUSP00000085633
Gene: ENSMUSG00000038181

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fringe 143 298 3.2e-11 PFAM
Pfam:CHGN 242 755 1.7e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121863
SMART Domains Protein: ENSMUSP00000112804
Gene: ENSMUSG00000038181

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fringe 143 298 3.2e-11 PFAM
Pfam:CHGN 242 755 3e-176 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195943
AA Change: A241D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143437
Gene: ENSMUSG00000028949
AA Change: A241D

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 43 60 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:KISc 74 210 2e-41 BLAST
SWIB 230 309 2.3e-31 SMART
Blast:MYSc 391 437 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000197318
SMART Domains Protein: ENSMUSP00000143185
Gene: ENSMUSG00000038181

DomainStartEndE-ValueType
Pfam:CHGN 1 74 7.5e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and has sequence similarity to the yeast Swp73 protein. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 C T 12: 81,559,119 C623Y probably damaging Het
Ago3 T C 4: 126,371,532 K322R probably null Het
Ankrd17 T C 5: 90,285,864 H682R possibly damaging Het
Aoah A G 13: 20,910,106 D187G probably damaging Het
Arhgap17 T C 7: 123,280,008 D840G unknown Het
AW551984 C T 9: 39,591,427 V650I probably benign Het
BC051142 C A 17: 34,440,882 T93N possibly damaging Het
Bok T A 1: 93,689,189 Y86N probably damaging Het
Ccdc146 T A 5: 21,305,274 N580I possibly damaging Het
Ccng2 T C 5: 93,269,340 S72P possibly damaging Het
Cfap74 T G 4: 155,455,677 I977S unknown Het
Cobl T C 11: 12,253,441 N1087S probably benign Het
Cyp21a1 C A 17: 34,802,359 R346L probably damaging Het
Eif4a1 A C 11: 69,670,664 F52L probably damaging Het
Eif4ebp2 A C 10: 61,433,801 I120S probably damaging Het
Enpp2 A C 15: 54,901,391 D146E probably benign Het
Exosc9 T C 3: 36,553,056 Y30H probably damaging Het
Fam117a G A 11: 95,377,672 G300S probably benign Het
Focad C A 4: 88,410,677 A1709E unknown Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Fsip2 T C 2: 82,983,152 F3272L probably benign Het
Gcnt2 G A 13: 40,860,420 M22I probably benign Het
Gjd4 T C 18: 9,280,928 E50G probably damaging Het
Gm10375 G T 14: 43,602,970 T162K probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gm4924 T C 10: 82,379,223 F952L unknown Het
Heatr1 T C 13: 12,418,164 F1132L possibly damaging Het
Hnrnpu A G 1: 178,332,191 Y442H unknown Het
Hp1bp3 C A 4: 138,239,618 T408N probably damaging Het
Htra3 A G 5: 35,668,316 V198A probably damaging Het
Katnal1 T C 5: 148,891,737 T300A probably benign Het
Lipo5 G T 19: 33,467,770 P133Q Het
Lrp1b A T 2: 41,770,846 H197Q Het
Mdc1 C A 17: 35,845,947 A82D probably damaging Het
Mstn A T 1: 53,064,249 D248V probably benign Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Ola1 G A 2: 73,141,964 T221I probably damaging Het
Olfr1086 T C 2: 86,676,892 Y147C possibly damaging Het
Olfr67 A G 7: 103,787,386 I297T probably damaging Het
Olfr857 T A 9: 19,713,132 S102T probably benign Het
Olfr898 T A 9: 38,349,970 Y290N probably damaging Het
Phldb1 T C 9: 44,711,904 T618A possibly damaging Het
Pkd1 T G 17: 24,591,119 W3565G probably damaging Het
Prl3a1 A T 13: 27,276,103 N190I probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn11 C T 5: 121,143,570 R484Q probably benign Het
Rapgef4 T C 2: 72,241,476 M900T probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Srgap2 A G 1: 131,344,449 M33T Het
Tle1 G C 4: 72,158,375 P139A probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Zfp658 T A 7: 43,573,989 S563T probably benign Het
Zswim9 G A 7: 13,259,752 R826C probably damaging Het
Other mutations in Smarcd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02401:Smarcd3 APN 5 24593719 missense probably damaging 1.00
R0135:Smarcd3 UTSW 5 24595499 unclassified probably benign
R1614:Smarcd3 UTSW 5 24594876 missense possibly damaging 0.93
R1617:Smarcd3 UTSW 5 24595194 missense probably damaging 1.00
R1753:Smarcd3 UTSW 5 24595822 nonsense probably null
R1879:Smarcd3 UTSW 5 24593021 missense probably damaging 0.99
R2307:Smarcd3 UTSW 5 24595748 missense probably damaging 1.00
R3800:Smarcd3 UTSW 5 24593227 nonsense probably null
R4592:Smarcd3 UTSW 5 24592804 missense probably benign 0.00
R6369:Smarcd3 UTSW 5 24594984 missense probably damaging 0.99
R6388:Smarcd3 UTSW 5 24596026 missense possibly damaging 0.94
R7078:Smarcd3 UTSW 5 24593069 missense probably damaging 0.98
R7341:Smarcd3 UTSW 5 24595437 missense possibly damaging 0.95
R7426:Smarcd3 UTSW 5 24595812 missense probably benign 0.30
R7806:Smarcd3 UTSW 5 24593262 missense probably benign 0.45
RF007:Smarcd3 UTSW 5 24596070 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAGGAGACAGCTACCTTTGGAG -3'
(R):5'- CTGCTCCTGATGCTGGACTATC -3'

Sequencing Primer
(F):5'- GGTGCTTCTGCTCCTCAGG -3'
(R):5'- GGACTATCAGGTTGGTTTTACCCC -3'
Posted On2019-05-15