Incidental Mutation 'R7077:Htra3'
ID549271
Institutional Source Beutler Lab
Gene Symbol Htra3
Ensembl Gene ENSMUSG00000029096
Gene NameHtrA serine peptidase 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7077 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location35652023-35679782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35668316 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 198 (V198A)
Ref Sequence ENSEMBL: ENSMUSP00000084910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087629] [ENSMUST00000114233] [ENSMUST00000129459] [ENSMUST00000137935] [ENSMUST00000201028]
Predicted Effect probably damaging
Transcript: ENSMUST00000087629
AA Change: V198A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000084910
Gene: ENSMUSG00000029096
AA Change: V198A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IB 29 89 1.6e-3 SMART
KAZAL 86 132 1.59e-7 SMART
Pfam:Trypsin 171 347 7.4e-15 PFAM
Pfam:Trypsin_2 181 325 1.4e-31 PFAM
PDZ 361 446 5.13e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114233
AA Change: V198A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109871
Gene: ENSMUSG00000029096
AA Change: V198A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IB 29 89 1.6e-3 SMART
KAZAL 86 132 1.59e-7 SMART
Pfam:Trypsin 171 347 4.4e-15 PFAM
Pfam:Trypsin_2 181 325 7.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129459
AA Change: V13A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144550
Gene: ENSMUSG00000029096
AA Change: V13A

DomainStartEndE-ValueType
Pfam:Trypsin_2 1 53 4.8e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000137935
AA Change: V13A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000201028
SMART Domains Protein: ENSMUSP00000144597
Gene: ENSMUSG00000029096

DomainStartEndE-ValueType
KAZAL 2 49 1.2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 C T 12: 81,559,119 C623Y probably damaging Het
Ago3 T C 4: 126,371,532 K322R probably null Het
Ankrd17 T C 5: 90,285,864 H682R possibly damaging Het
Aoah A G 13: 20,910,106 D187G probably damaging Het
Arhgap17 T C 7: 123,280,008 D840G unknown Het
AW551984 C T 9: 39,591,427 V650I probably benign Het
BC051142 C A 17: 34,440,882 T93N possibly damaging Het
Bok T A 1: 93,689,189 Y86N probably damaging Het
Ccdc146 T A 5: 21,305,274 N580I possibly damaging Het
Ccng2 T C 5: 93,269,340 S72P possibly damaging Het
Cfap74 T G 4: 155,455,677 I977S unknown Het
Cobl T C 11: 12,253,441 N1087S probably benign Het
Cyp21a1 C A 17: 34,802,359 R346L probably damaging Het
Eif4a1 A C 11: 69,670,664 F52L probably damaging Het
Eif4ebp2 A C 10: 61,433,801 I120S probably damaging Het
Enpp2 A C 15: 54,901,391 D146E probably benign Het
Exosc9 T C 3: 36,553,056 Y30H probably damaging Het
Fam117a G A 11: 95,377,672 G300S probably benign Het
Focad C A 4: 88,410,677 A1709E unknown Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Fsip2 T C 2: 82,983,152 F3272L probably benign Het
Gcnt2 G A 13: 40,860,420 M22I probably benign Het
Gjd4 T C 18: 9,280,928 E50G probably damaging Het
Gm10375 G T 14: 43,602,970 T162K probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gm4924 T C 10: 82,379,223 F952L unknown Het
Heatr1 T C 13: 12,418,164 F1132L possibly damaging Het
Hnrnpu A G 1: 178,332,191 Y442H unknown Het
Hp1bp3 C A 4: 138,239,618 T408N probably damaging Het
Katnal1 T C 5: 148,891,737 T300A probably benign Het
Lipo5 G T 19: 33,467,770 P133Q Het
Lrp1b A T 2: 41,770,846 H197Q Het
Mdc1 C A 17: 35,845,947 A82D probably damaging Het
Mstn A T 1: 53,064,249 D248V probably benign Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Ola1 G A 2: 73,141,964 T221I probably damaging Het
Olfr1086 T C 2: 86,676,892 Y147C possibly damaging Het
Olfr67 A G 7: 103,787,386 I297T probably damaging Het
Olfr857 T A 9: 19,713,132 S102T probably benign Het
Olfr898 T A 9: 38,349,970 Y290N probably damaging Het
Phldb1 T C 9: 44,711,904 T618A possibly damaging Het
Pkd1 T G 17: 24,591,119 W3565G probably damaging Het
Prl3a1 A T 13: 27,276,103 N190I probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn11 C T 5: 121,143,570 R484Q probably benign Het
Rapgef4 T C 2: 72,241,476 M900T probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Smarcd3 G T 5: 24,594,962 A270D probably damaging Het
Srgap2 A G 1: 131,344,449 M33T Het
Tle1 G C 4: 72,158,375 P139A probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Zfp658 T A 7: 43,573,989 S563T probably benign Het
Zswim9 G A 7: 13,259,752 R826C probably damaging Het
Other mutations in Htra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Htra3 APN 5 35664076 unclassified probably null
IGL02092:Htra3 APN 5 35671072 missense probably damaging 0.97
IGL02164:Htra3 APN 5 35653066 missense probably benign 0.26
IGL03123:Htra3 APN 5 35666133 missense probably damaging 1.00
R0412:Htra3 UTSW 5 35671065 missense probably damaging 1.00
R0720:Htra3 UTSW 5 35654109 missense probably damaging 0.99
R0962:Htra3 UTSW 5 35668356 missense probably damaging 0.98
R3785:Htra3 UTSW 5 35671128 missense probably benign 0.00
R4995:Htra3 UTSW 5 35671074 missense probably damaging 0.99
R4999:Htra3 UTSW 5 35671125 missense probably benign
R5316:Htra3 UTSW 5 35664076 missense probably damaging 1.00
R5940:Htra3 UTSW 5 35652980 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGGGTGTGGATCTGACTAGAAC -3'
(R):5'- AGTTCAAACCCAGGTGGAGG -3'

Sequencing Primer
(F):5'- TGTGGATCTGACTAGAACAGTAAAG -3'
(R):5'- CCAGGTGGAGGAGGAAGTGTTC -3'
Posted On2019-05-15