Incidental Mutation 'R7077:Katnal1'
ID549275
Institutional Source Beutler Lab
Gene Symbol Katnal1
Ensembl Gene ENSMUSG00000041298
Gene Namekatanin p60 subunit A-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R7077 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location148871584-148929320 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148891737 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 300 (T300A)
Ref Sequence ENSEMBL: ENSMUSP00000043210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047257] [ENSMUST00000110509] [ENSMUST00000147473]
Predicted Effect probably benign
Transcript: ENSMUST00000047257
AA Change: T300A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000043210
Gene: ENSMUSG00000041298
AA Change: T300A

DomainStartEndE-ValueType
PDB:2RPA|A 1 72 3e-19 PDB
low complexity region 100 111 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
AAA 238 380 3.01e-20 SMART
Pfam:Vps4_C 437 486 2.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110509
SMART Domains Protein: ENSMUSP00000106136
Gene: ENSMUSG00000041298

DomainStartEndE-ValueType
PDB:2RPA|A 1 72 3e-20 PDB
low complexity region 100 111 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
Blast:AAA 159 229 8e-7 BLAST
PDB:4L16|A 184 234 3e-8 PDB
SCOP:d1iqpa2 185 234 4e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147473
SMART Domains Protein: ENSMUSP00000120502
Gene: ENSMUSG00000106892

DomainStartEndE-ValueType
PDB:2RPA|A 1 72 1e-20 PDB
low complexity region 100 111 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU induced mutation display male infertility with decreased testis weight and premature exfoliation of spermatids from the seminiferous epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 C T 12: 81,559,119 C623Y probably damaging Het
Ago3 T C 4: 126,371,532 K322R probably null Het
Ankrd17 T C 5: 90,285,864 H682R possibly damaging Het
Aoah A G 13: 20,910,106 D187G probably damaging Het
Arhgap17 T C 7: 123,280,008 D840G unknown Het
AW551984 C T 9: 39,591,427 V650I probably benign Het
BC051142 C A 17: 34,440,882 T93N possibly damaging Het
Bok T A 1: 93,689,189 Y86N probably damaging Het
Ccdc146 T A 5: 21,305,274 N580I possibly damaging Het
Ccng2 T C 5: 93,269,340 S72P possibly damaging Het
Cfap74 T G 4: 155,455,677 I977S unknown Het
Cobl T C 11: 12,253,441 N1087S probably benign Het
Cyp21a1 C A 17: 34,802,359 R346L probably damaging Het
Eif4a1 A C 11: 69,670,664 F52L probably damaging Het
Eif4ebp2 A C 10: 61,433,801 I120S probably damaging Het
Enpp2 A C 15: 54,901,391 D146E probably benign Het
Exosc9 T C 3: 36,553,056 Y30H probably damaging Het
Fam117a G A 11: 95,377,672 G300S probably benign Het
Focad C A 4: 88,410,677 A1709E unknown Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Fsip2 T C 2: 82,983,152 F3272L probably benign Het
Gcnt2 G A 13: 40,860,420 M22I probably benign Het
Gjd4 T C 18: 9,280,928 E50G probably damaging Het
Gm10375 G T 14: 43,602,970 T162K probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gm4924 T C 10: 82,379,223 F952L unknown Het
Heatr1 T C 13: 12,418,164 F1132L possibly damaging Het
Hnrnpu A G 1: 178,332,191 Y442H unknown Het
Hp1bp3 C A 4: 138,239,618 T408N probably damaging Het
Htra3 A G 5: 35,668,316 V198A probably damaging Het
Lipo5 G T 19: 33,467,770 P133Q Het
Lrp1b A T 2: 41,770,846 H197Q Het
Mdc1 C A 17: 35,845,947 A82D probably damaging Het
Mstn A T 1: 53,064,249 D248V probably benign Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Ola1 G A 2: 73,141,964 T221I probably damaging Het
Olfr1086 T C 2: 86,676,892 Y147C possibly damaging Het
Olfr67 A G 7: 103,787,386 I297T probably damaging Het
Olfr857 T A 9: 19,713,132 S102T probably benign Het
Olfr898 T A 9: 38,349,970 Y290N probably damaging Het
Phldb1 T C 9: 44,711,904 T618A possibly damaging Het
Pkd1 T G 17: 24,591,119 W3565G probably damaging Het
Prl3a1 A T 13: 27,276,103 N190I probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn11 C T 5: 121,143,570 R484Q probably benign Het
Rapgef4 T C 2: 72,241,476 M900T probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Smarcd3 G T 5: 24,594,962 A270D probably damaging Het
Srgap2 A G 1: 131,344,449 M33T Het
Tle1 G C 4: 72,158,375 P139A probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Zfp658 T A 7: 43,573,989 S563T probably benign Het
Zswim9 G A 7: 13,259,752 R826C probably damaging Het
Other mutations in Katnal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Katnal1 APN 5 148893797 splice site probably benign
IGL02369:Katnal1 APN 5 148878927 missense probably benign 0.04
R0001:Katnal1 UTSW 5 148921275 missense probably damaging 0.98
R0230:Katnal1 UTSW 5 148918650 missense possibly damaging 0.60
R0308:Katnal1 UTSW 5 148878924 missense possibly damaging 0.95
R0591:Katnal1 UTSW 5 148892516 missense probably damaging 1.00
R1220:Katnal1 UTSW 5 148894251 missense probably benign 0.00
R1448:Katnal1 UTSW 5 148904676 missense probably benign 0.37
R2163:Katnal1 UTSW 5 148888936 missense probably damaging 1.00
R4791:Katnal1 UTSW 5 148904650 missense probably damaging 1.00
R5168:Katnal1 UTSW 5 148921322 missense possibly damaging 0.91
R6182:Katnal1 UTSW 5 148904597 missense possibly damaging 0.83
R6542:Katnal1 UTSW 5 148876206 missense probably benign 0.01
R6836:Katnal1 UTSW 5 148894164 missense probably damaging 1.00
R7490:Katnal1 UTSW 5 148891682 missense probably null 0.00
Predicted Primers PCR Primer
(F):5'- AAAAGTGAGTCACAGCTGCC -3'
(R):5'- TTTCACTCAGCATCACCAACTATG -3'

Sequencing Primer
(F):5'- CACTGAGAACTTTCAGAGCATG -3'
(R):5'- AGTTTTATTTTTGAATTGGCTGTTCC -3'
Posted On2019-05-15