Mutagenetix > Incidental Mutations

Incidental Mutation 'R7077:Olfr67'

549278

Institutional Source

Beutler Lab

Gene Symbol

Olfr67

Ensembl Gene

ENSMUSG00000047535

Gene Name

olfactory receptor 67

Synonyms

GA_x6K02T2PBJ9-6515150-6514170, 3'[b]1, MOR31-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R7077 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103784594-103791821 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 103787386 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 297 (I297T)

Ref Sequence

ENSEMBL: ENSMUSP00000138389 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000183254]

Predicted Effect

probably damaging
Transcript: ENSMUST00000183254
AA Change: I297T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000138389
Gene: ENSMUSG00000047535
AA Change: I297T

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srsx	41	231	5.5e-11	PFAM
Pfam:7tm_1	47	299	2.7e-30	PFAM
Pfam:7tm_4	146	292	1.7e-29	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam21	C	T	12: 81,559,119	C623Y	probably damaging	Het
Ago3	T	C	4: 126,371,532	K322R	probably null	Het
Ankrd17	T	C	5: 90,285,864	H682R	possibly damaging	Het
Aoah	A	G	13: 20,910,106	D187G	probably damaging	Het
Arhgap17	T	C	7: 123,280,008	D840G	unknown	Het
AW551984	C	T	9: 39,591,427	V650I	probably benign	Het
BC051142	C	A	17: 34,440,882	T93N	possibly damaging	Het
Bok	T	A	1: 93,689,189	Y86N	probably damaging	Het
Ccdc146	T	A	5: 21,305,274	N580I	possibly damaging	Het
Ccng2	T	C	5: 93,269,340	S72P	possibly damaging	Het
Cfap74	T	G	4: 155,455,677	I977S	unknown	Het
Cobl	T	C	11: 12,253,441	N1087S	probably benign	Het
Cyp21a1	C	A	17: 34,802,359	R346L	probably damaging	Het
Eif4a1	A	C	11: 69,670,664	F52L	probably damaging	Het
Eif4ebp2	A	C	10: 61,433,801	I120S	probably damaging	Het
Enpp2	A	C	15: 54,901,391	D146E	probably benign	Het
Exosc9	T	C	3: 36,553,056	Y30H	probably damaging	Het
Fam117a	G	A	11: 95,377,672	G300S	probably benign	Het
Focad	C	A	4: 88,410,677	A1709E	unknown	Het
Fsd1	G	A	17: 55,993,876	R245H	probably damaging	Het
Fsip2	T	C	2: 82,983,152	F3272L	probably benign	Het
Gcnt2	G	A	13: 40,860,420	M22I	probably benign	Het
Gjd4	T	C	18: 9,280,928	E50G	probably damaging	Het
Gm10375	G	T	14: 43,602,970	T162K	probably benign	Het
Gm10837	C	G	14: 122,490,730	A6G	unknown	Het
Gm4924	T	C	10: 82,379,223	F952L	unknown	Het
Heatr1	T	C	13: 12,418,164	F1132L	possibly damaging	Het
Hnrnpu	A	G	1: 178,332,191	Y442H	unknown	Het
Hp1bp3	C	A	4: 138,239,618	T408N	probably damaging	Het
Htra3	A	G	5: 35,668,316	V198A	probably damaging	Het
Katnal1	T	C	5: 148,891,737	T300A	probably benign	Het
Lipo5	G	T	19: 33,467,770	P133Q		Het
Lrp1b	A	T	2: 41,770,846	H197Q		Het
Mdc1	C	A	17: 35,845,947	A82D	probably damaging	Het
Mstn	A	T	1: 53,064,249	D248V	probably benign	Het
Myo1d	C	T	11: 80,674,634	E426K	probably damaging	Het
Ola1	G	A	2: 73,141,964	T221I	probably damaging	Het
Olfr1086	T	C	2: 86,676,892	Y147C	possibly damaging	Het
Olfr857	T	A	9: 19,713,132	S102T	probably benign	Het
Olfr898	T	A	9: 38,349,970	Y290N	probably damaging	Het
Phldb1	T	C	9: 44,711,904	T618A	possibly damaging	Het
Pkd1	T	G	17: 24,591,119	W3565G	probably damaging	Het
Prl3a1	A	T	13: 27,276,103	N190I	probably benign	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Ptpn11	C	T	5: 121,143,570	R484Q	probably benign	Het
Rapgef4	T	C	2: 72,241,476	M900T	probably damaging	Het
Slc1a2	A	T	2: 102,777,510	D501V	probably benign	Het
Smarcd3	G	T	5: 24,594,962	A270D	probably damaging	Het
Srgap2	A	G	1: 131,344,449	M33T		Het
Tle1	G	C	4: 72,158,375	P139A	probably benign	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Zfp658	T	A	7: 43,573,989	S563T	probably benign	Het
Zswim9	G	A	7: 13,259,752	R826C	probably damaging	Het

Other mutations in Olfr67

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01160:Olfr67	APN	7	103787636	missense	probably damaging	0.97
IGL01352:Olfr67	APN	7	103788078	nonsense	probably null	0.00
IGL02318:Olfr67	APN	7	103788268	missense	probably benign
R0413:Olfr67	UTSW	7	103788155	missense	probably damaging	1.00
R0964:Olfr67	UTSW	7	103787397	missense	probably benign	0.18
R2092:Olfr67	UTSW	7	103788072	missense	possibly damaging	0.50
R3963:Olfr67	UTSW	7	103788034	missense	probably benign	0.02
R4299:Olfr67	UTSW	7	103787995	missense	probably benign	0.38
R4799:Olfr67	UTSW	7	103787481	missense	possibly damaging	0.49
R5410:Olfr67	UTSW	7	103787374	missense	probably damaging	0.97
R5959:Olfr67	UTSW	7	103787516	missense	probably damaging	0.99
R6084:Olfr67	UTSW	7	103787955	missense	probably benign	0.11
R6336:Olfr67	UTSW	7	103788245	missense	possibly damaging	0.86
R7453:Olfr67	UTSW	7	103787672	missense	possibly damaging	0.90
Z1088:Olfr67	UTSW	7	103787365	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCCTCTTGAAAGTGAAGCACTC -3'
(R):5'- ACACCATGATTCTTCGCACTG -3'

Sequencing Primer
(F):5'- CTATTCTCACAGGGATGACAT -3'
(R):5'- TTCCTGGGCTGCCAGATACAAG -3'

Posted On

2019-05-15