Incidental Mutation 'R0614:Olfr348'
ID54928
Institutional Source Beutler Lab
Gene Symbol Olfr348
Ensembl Gene ENSMUSG00000049315
Gene Nameolfactory receptor 348
SynonymsGA_x6K02T2NLDC-33481050-33481991, MOR136-8
MMRRC Submission 038803-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R0614 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36784276-36789998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36786693 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 56 (L56H)
Ref Sequence ENSEMBL: ENSMUSP00000150343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056865] [ENSMUST00000112950] [ENSMUST00000213498] [ENSMUST00000214909] [ENSMUST00000215199] [ENSMUST00000216753] [ENSMUST00000217041]
Predicted Effect probably damaging
Transcript: ENSMUST00000056865
AA Change: L56H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054037
Gene: ENSMUSG00000049315
AA Change: L56H

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.3e-56 PFAM
Pfam:7TM_GPCR_Srsx 36 306 3e-6 PFAM
Pfam:7tm_1 42 291 2.7e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112950
AA Change: L56H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108572
Gene: ENSMUSG00000111021
AA Change: L56H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 36 306 3e-6 PFAM
Pfam:7tm_1 42 291 3.5e-34 PFAM
Pfam:7tm_4 140 284 3.9e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213498
AA Change: L56H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214909
AA Change: L56H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215199
AA Change: L56H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216753
Predicted Effect probably benign
Transcript: ENSMUST00000217041
Meta Mutation Damage Score 0.8577 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,192,663 T137I probably benign Het
3110082I17Rik C T 5: 139,364,031 V88I possibly damaging Het
4930453N24Rik T A 16: 64,766,614 Q249L probably damaging Het
Akap2 C A 4: 57,856,720 A926E probably benign Het
Ap1g2 C T 14: 55,099,773 V702I probably benign Het
Armcx5 G A X: 135,746,815 E547K probably damaging Het
Asah2 C A 19: 32,016,728 V406L probably damaging Het
Atp8b1 T C 18: 64,533,587 probably benign Het
Axl C A 7: 25,774,163 R346L probably benign Het
Baz1a G A 12: 54,941,519 R282* probably null Het
Card14 A G 11: 119,322,827 N200S probably benign Het
Cdt1 A G 8: 122,568,137 T28A probably benign Het
Cep250 C T 2: 155,970,097 Q438* probably null Het
Dapk1 C A 13: 60,718,132 P181Q probably damaging Het
Dnah17 C T 11: 118,070,568 probably benign Het
Dph7 T C 2: 24,968,956 probably null Het
Edc4 A T 8: 105,889,396 D801V possibly damaging Het
Eif4g2 A G 7: 111,077,223 probably null Het
Eml2 T C 7: 19,202,591 L531P probably damaging Het
Ephb2 T C 4: 136,673,365 Y533C probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fsip2 A G 2: 82,977,533 K1399E probably benign Het
Hcls1 A G 16: 36,962,625 D446G probably damaging Het
Hif1a T A 12: 73,945,631 N787K probably damaging Het
Ints14 T C 9: 64,964,433 S18P probably benign Het
Kalrn A T 16: 33,993,670 probably benign Het
Llgl2 T A 11: 115,850,267 D502E probably damaging Het
Lrwd1 A G 5: 136,123,500 V570A probably damaging Het
Mga C G 2: 119,964,466 P2877R probably damaging Het
Mvd T C 8: 122,436,553 I313V probably benign Het
Myo15b C A 11: 115,882,913 P270T probably damaging Het
Naip1 C A 13: 100,444,200 V180L probably benign Het
Ofd1 T C X: 166,435,540 probably benign Het
Olfr1233 T A 2: 89,339,985 I106F probably damaging Het
Olfr1423 A T 19: 12,036,565 M59K possibly damaging Het
Otogl G A 10: 107,798,355 P1420S probably benign Het
Pcnt C T 10: 76,420,316 V697M probably damaging Het
Plekha7 A T 7: 116,154,645 Y702* probably null Het
Plxnb3 A G X: 73,764,358 probably benign Het
Ptgis A G 2: 167,206,882 F405L probably damaging Het
Ptprk C T 10: 28,075,136 P19L probably damaging Het
Ptprt A G 2: 161,812,120 V530A possibly damaging Het
Rasgrp4 A T 7: 29,145,851 Y299F probably damaging Het
Slc39a11 T A 11: 113,523,626 probably null Het
Slc6a15 T A 10: 103,404,352 L312* probably null Het
Slf1 T A 13: 77,049,114 M794L probably benign Het
Sntg2 G A 12: 30,257,978 T236I possibly damaging Het
Stau1 T C 2: 166,950,806 Y413C probably damaging Het
Syne2 T G 12: 75,912,353 probably null Het
Tas2r104 A T 6: 131,685,202 N181K probably damaging Het
Tmem81 G A 1: 132,507,731 V92I probably benign Het
Trap1 A G 16: 4,060,751 probably benign Het
Trip12 T C 1: 84,757,761 E905G probably damaging Het
Usp2 C T 9: 44,092,492 R494* probably null Het
Vps13a G T 19: 16,652,694 R2692S probably damaging Het
Zfhx3 T C 8: 108,948,539 S2074P probably benign Het
Zfhx3 C G 8: 108,948,967 Y2216* probably null Het
Zfp423 A G 8: 87,782,114 F409S probably damaging Het
Zfp472 G A 17: 32,977,934 E328K possibly damaging Het
Zfp619 T A 7: 39,537,675 M1043K possibly damaging Het
Zfp940 T C 7: 29,846,246 I79V probably benign Het
Other mutations in Olfr348
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Olfr348 APN 2 36787355 missense probably benign 0.03
IGL01943:Olfr348 APN 2 36787083 missense probably benign 0.13
IGL02030:Olfr348 APN 2 36787398 missense probably damaging 1.00
IGL02338:Olfr348 APN 2 36786545 nonsense probably null
IGL02349:Olfr348 APN 2 36787046 missense possibly damaging 0.95
IGL02695:Olfr348 APN 2 36787320 missense possibly damaging 0.72
IGL03004:Olfr348 APN 2 36787182 missense probably damaging 1.00
IGL03007:Olfr348 APN 2 36786800 missense probably damaging 0.99
IGL03024:Olfr348 APN 2 36786846 missense possibly damaging 0.55
R0360:Olfr348 UTSW 2 36787440 missense probably benign 0.03
R0388:Olfr348 UTSW 2 36786862 missense probably benign 0.43
R1498:Olfr348 UTSW 2 36787346 missense probably damaging 1.00
R1562:Olfr348 UTSW 2 36786684 missense probably damaging 1.00
R2882:Olfr348 UTSW 2 36787190 missense probably damaging 1.00
R3731:Olfr348 UTSW 2 36786566 missense possibly damaging 0.53
R4513:Olfr348 UTSW 2 36786770 missense probably benign 0.05
R4899:Olfr348 UTSW 2 36786798 missense probably benign 0.04
R5005:Olfr348 UTSW 2 36787358 missense probably benign
R5035:Olfr348 UTSW 2 36786891 missense probably damaging 1.00
R5490:Olfr348 UTSW 2 36787181 missense probably damaging 1.00
R6361:Olfr348 UTSW 2 36786780 missense probably damaging 1.00
R7762:Olfr348 UTSW 2 36787010 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCATCTCAAGCAGAAGATGAAGAGCAC -3'
(R):5'- TGCACAAGGGCACCAGCAAATG -3'

Sequencing Primer
(F):5'- CAAGGAACCAGAGCAGTGC -3'
(R):5'- CAGATACTCTGACTCATGATTCTTG -3'
Posted On2013-07-11