Incidental Mutation 'R7077:Myo1d'
ID549288
Institutional Source Beutler Lab
Gene Symbol Myo1d
Ensembl Gene ENSMUSG00000035441
Gene Namemyosin ID
Synonyms9930104H07Rik, D11Ertd9e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7077 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location80482126-80780025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80674634 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 426 (E426K)
Ref Sequence ENSEMBL: ENSMUSP00000066948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000070997]
Predicted Effect probably damaging
Transcript: ENSMUST00000041065
AA Change: E426K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: E426K

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 803 1006 4.1e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000070997
AA Change: E426K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066948
Gene: ENSMUSG00000035441
AA Change: E426K

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 802 913 1.8e-26 PFAM
Meta Mutation Damage Score 0.9568 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 C T 12: 81,559,119 C623Y probably damaging Het
Ago3 T C 4: 126,371,532 K322R probably null Het
Ankrd17 T C 5: 90,285,864 H682R possibly damaging Het
Aoah A G 13: 20,910,106 D187G probably damaging Het
Arhgap17 T C 7: 123,280,008 D840G unknown Het
AW551984 C T 9: 39,591,427 V650I probably benign Het
BC051142 C A 17: 34,440,882 T93N possibly damaging Het
Bok T A 1: 93,689,189 Y86N probably damaging Het
Ccdc146 T A 5: 21,305,274 N580I possibly damaging Het
Ccng2 T C 5: 93,269,340 S72P possibly damaging Het
Cfap74 T G 4: 155,455,677 I977S unknown Het
Cobl T C 11: 12,253,441 N1087S probably benign Het
Cyp21a1 C A 17: 34,802,359 R346L probably damaging Het
Eif4a1 A C 11: 69,670,664 F52L probably damaging Het
Eif4ebp2 A C 10: 61,433,801 I120S probably damaging Het
Enpp2 A C 15: 54,901,391 D146E probably benign Het
Exosc9 T C 3: 36,553,056 Y30H probably damaging Het
Fam117a G A 11: 95,377,672 G300S probably benign Het
Focad C A 4: 88,410,677 A1709E unknown Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Fsip2 T C 2: 82,983,152 F3272L probably benign Het
Gcnt2 G A 13: 40,860,420 M22I probably benign Het
Gjd4 T C 18: 9,280,928 E50G probably damaging Het
Gm10375 G T 14: 43,602,970 T162K probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gm4924 T C 10: 82,379,223 F952L unknown Het
Heatr1 T C 13: 12,418,164 F1132L possibly damaging Het
Hnrnpu A G 1: 178,332,191 Y442H unknown Het
Hp1bp3 C A 4: 138,239,618 T408N probably damaging Het
Htra3 A G 5: 35,668,316 V198A probably damaging Het
Katnal1 T C 5: 148,891,737 T300A probably benign Het
Lipo5 G T 19: 33,467,770 P133Q Het
Lrp1b A T 2: 41,770,846 H197Q Het
Mdc1 C A 17: 35,845,947 A82D probably damaging Het
Mstn A T 1: 53,064,249 D248V probably benign Het
Ola1 G A 2: 73,141,964 T221I probably damaging Het
Olfr1086 T C 2: 86,676,892 Y147C possibly damaging Het
Olfr67 A G 7: 103,787,386 I297T probably damaging Het
Olfr857 T A 9: 19,713,132 S102T probably benign Het
Olfr898 T A 9: 38,349,970 Y290N probably damaging Het
Phldb1 T C 9: 44,711,904 T618A possibly damaging Het
Pkd1 T G 17: 24,591,119 W3565G probably damaging Het
Prl3a1 A T 13: 27,276,103 N190I probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn11 C T 5: 121,143,570 R484Q probably benign Het
Rapgef4 T C 2: 72,241,476 M900T probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Smarcd3 G T 5: 24,594,962 A270D probably damaging Het
Srgap2 A G 1: 131,344,449 M33T Het
Tle1 G C 4: 72,158,375 P139A probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Zfp658 T A 7: 43,573,989 S563T probably benign Het
Zswim9 G A 7: 13,259,752 R826C probably damaging Het
Other mutations in Myo1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Myo1d APN 11 80601740 missense probably benign
IGL01087:Myo1d APN 11 80682435 missense probably damaging 1.00
IGL01326:Myo1d APN 11 80684321 splice site probably benign
IGL01431:Myo1d APN 11 80674839 missense probably damaging 1.00
IGL01595:Myo1d APN 11 80676110 missense probably benign 0.00
IGL01811:Myo1d APN 11 80692997 missense probably damaging 0.96
IGL02301:Myo1d APN 11 80676853 missense probably benign 0.23
IGL02388:Myo1d APN 11 80637997 nonsense probably null
IGL02485:Myo1d APN 11 80666581 missense probably damaging 1.00
IGL03017:Myo1d APN 11 80601626 missense probably benign 0.26
horton UTSW 11 80674708 missense probably damaging 1.00
multifaceted UTSW 11 80693072 missense probably damaging 1.00
whisper UTSW 11 80484332 missense probably damaging 0.99
whisper2 UTSW 11 80666578 missense probably damaging 1.00
whisper3 UTSW 11 80557521 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0069:Myo1d UTSW 11 80637953 missense probably damaging 1.00
R0081:Myo1d UTSW 11 80557523 missense probably benign 0.00
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0096:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0244:Myo1d UTSW 11 80674708 missense probably damaging 1.00
R0711:Myo1d UTSW 11 80484332 missense probably damaging 0.99
R0746:Myo1d UTSW 11 80586879 missense possibly damaging 0.94
R1084:Myo1d UTSW 11 80684395 missense probably damaging 1.00
R1514:Myo1d UTSW 11 80685908 missense probably damaging 0.97
R1676:Myo1d UTSW 11 80684421 missense probably damaging 1.00
R1862:Myo1d UTSW 11 80663048 missense probably damaging 1.00
R2497:Myo1d UTSW 11 80674821 missense probably damaging 1.00
R2512:Myo1d UTSW 11 80779717 missense probably benign 0.00
R3425:Myo1d UTSW 11 80601638 missense probably benign
R3429:Myo1d UTSW 11 80682410 missense probably damaging 1.00
R3917:Myo1d UTSW 11 80666578 missense probably damaging 1.00
R3928:Myo1d UTSW 11 80484261 missense probably benign 0.09
R4706:Myo1d UTSW 11 80666641 missense probably damaging 0.96
R4723:Myo1d UTSW 11 80779841 utr 5 prime probably benign
R4924:Myo1d UTSW 11 80674678 missense probably damaging 1.00
R5042:Myo1d UTSW 11 80557521 missense probably damaging 1.00
R5320:Myo1d UTSW 11 80684323 critical splice donor site probably null
R5481:Myo1d UTSW 11 80663095 missense possibly damaging 0.79
R6214:Myo1d UTSW 11 80779791 start codon destroyed probably null 0.98
R6235:Myo1d UTSW 11 80692944 missense probably benign 0.23
R6282:Myo1d UTSW 11 80557512 missense probably damaging 0.99
R6468:Myo1d UTSW 11 80557474 missense probably benign 0.00
R6668:Myo1d UTSW 11 80583875 intron probably benign
R6954:Myo1d UTSW 11 80674957 missense probably benign 0.21
R7078:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7080:Myo1d UTSW 11 80674634 missense probably damaging 1.00
R7172:Myo1d UTSW 11 80592795 missense probably benign 0.16
R7276:Myo1d UTSW 11 80693072 missense probably damaging 1.00
R7467:Myo1d UTSW 11 80586917 missense probably damaging 1.00
R7650:Myo1d UTSW 11 80601684 missense probably benign
R7678:Myo1d UTSW 11 80676893 missense possibly damaging 0.80
R7859:Myo1d UTSW 11 80684377 missense probably damaging 1.00
R7942:Myo1d UTSW 11 80684377 missense probably damaging 1.00
Z1088:Myo1d UTSW 11 80674898 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGGAATGACTCCTCTCCAG -3'
(R):5'- ATGACACCACGATACATGGG -3'

Sequencing Primer
(F):5'- AACAACTGAGTCGGGAAATAAGTTC -3'
(R):5'- GAAAAACACGGTTATTGGTGTCTTG -3'
Posted On2019-05-15