Mutagenetix > Incidental Mutation

Incidental Mutation 'R7077:Myo1d'

549288

Institutional Source

Beutler Lab

Gene Symbol

Myo1d

Ensembl Gene

ENSMUSG00000035441

Gene Name

myosin ID

Synonyms

9930104H07Rik, D11Ertd9e

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7077 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80482126-80780025 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 80674634 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 426 (E426K)

Ref Sequence

ENSEMBL: ENSMUSP00000066948 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000070997]

AlphaFold

Q5SYD0

Predicted Effect

probably damaging
Transcript: ENSMUST00000041065
AA Change: E426K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: E426K

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	803	1006	4.1e-49	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000070997
AA Change: E426K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000066948
Gene: ENSMUSG00000035441
AA Change: E426K

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	802	913	1.8e-26	PFAM

Meta Mutation Damage Score

0.9568

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (54/55)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam21	C	T	12: 81,559,119	C623Y	probably damaging	Het
Ago3	T	C	4: 126,371,532	K322R	probably null	Het
Ankrd17	T	C	5: 90,285,864	H682R	possibly damaging	Het
Aoah	A	G	13: 20,910,106	D187G	probably damaging	Het
Arhgap17	T	C	7: 123,280,008	D840G	unknown	Het
AW551984	C	T	9: 39,591,427	V650I	probably benign	Het
BC051142	C	A	17: 34,440,882	T93N	possibly damaging	Het
Bok	T	A	1: 93,689,189	Y86N	probably damaging	Het
Ccdc146	T	A	5: 21,305,274	N580I	possibly damaging	Het
Ccng2	T	C	5: 93,269,340	S72P	possibly damaging	Het
Cfap74	T	G	4: 155,455,677	I977S	unknown	Het
Cobl	T	C	11: 12,253,441	N1087S	probably benign	Het
Cyp21a1	C	A	17: 34,802,359	R346L	probably damaging	Het
Eif4a1	A	C	11: 69,670,664	F52L	probably damaging	Het
Eif4ebp2	A	C	10: 61,433,801	I120S	probably damaging	Het
Enpp2	A	C	15: 54,901,391	D146E	probably benign	Het
Exosc9	T	C	3: 36,553,056	Y30H	probably damaging	Het
Fam117a	G	A	11: 95,377,672	G300S	probably benign	Het
Focad	C	A	4: 88,410,677	A1709E	unknown	Het
Fsd1	G	A	17: 55,993,876	R245H	probably damaging	Het
Fsip2	T	C	2: 82,983,152	F3272L	probably benign	Het
Gcnt2	G	A	13: 40,860,420	M22I	probably benign	Het
Gjd4	T	C	18: 9,280,928	E50G	probably damaging	Het
Gm10375	G	T	14: 43,602,970	T162K	probably benign	Het
Gm10837	C	G	14: 122,490,730	A6G	unknown	Het
Gm4924	T	C	10: 82,379,223	F952L	unknown	Het
Heatr1	T	C	13: 12,418,164	F1132L	possibly damaging	Het
Hnrnpu	A	G	1: 178,332,191	Y442H	unknown	Het
Hp1bp3	C	A	4: 138,239,618	T408N	probably damaging	Het
Htra3	A	G	5: 35,668,316	V198A	probably damaging	Het
Katnal1	T	C	5: 148,891,737	T300A	probably benign	Het
Lipo5	G	T	19: 33,467,770	P133Q		Het
Lrp1b	A	T	2: 41,770,846	H197Q		Het
Mdc1	C	A	17: 35,845,947	A82D	probably damaging	Het
Mstn	A	T	1: 53,064,249	D248V	probably benign	Het
Ola1	G	A	2: 73,141,964	T221I	probably damaging	Het
Olfr1086	T	C	2: 86,676,892	Y147C	possibly damaging	Het
Olfr67	A	G	7: 103,787,386	I297T	probably damaging	Het
Olfr857	T	A	9: 19,713,132	S102T	probably benign	Het
Olfr898	T	A	9: 38,349,970	Y290N	probably damaging	Het
Phldb1	T	C	9: 44,711,904	T618A	possibly damaging	Het
Pkd1	T	G	17: 24,591,119	W3565G	probably damaging	Het
Prl3a1	A	T	13: 27,276,103	N190I	probably benign	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Ptpn11	C	T	5: 121,143,570	R484Q	probably benign	Het
Rapgef4	T	C	2: 72,241,476	M900T	probably damaging	Het
Slc1a2	A	T	2: 102,777,510	D501V	probably benign	Het
Smarcd3	G	T	5: 24,594,962	A270D	probably damaging	Het
Srgap2	A	G	1: 131,344,449	M33T		Het
Tle1	G	C	4: 72,158,375	P139A	probably benign	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Zfp658	T	A	7: 43,573,989	S563T	probably benign	Het
Zswim9	G	A	7: 13,259,752	R826C	probably damaging	Het

Other mutations in Myo1d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Myo1d	APN	11	80601740	missense	probably benign
IGL01087:Myo1d	APN	11	80682435	missense	probably damaging	1.00
IGL01326:Myo1d	APN	11	80684321	splice site	probably benign
IGL01431:Myo1d	APN	11	80674839	missense	probably damaging	1.00
IGL01595:Myo1d	APN	11	80676110	missense	probably benign	0.00
IGL01811:Myo1d	APN	11	80692997	missense	probably damaging	0.96
IGL02301:Myo1d	APN	11	80676853	missense	probably benign	0.23
IGL02388:Myo1d	APN	11	80637997	nonsense	probably null
IGL02485:Myo1d	APN	11	80666581	missense	probably damaging	1.00
IGL03017:Myo1d	APN	11	80601626	missense	probably benign	0.26
horton	UTSW	11	80674708	missense	probably damaging	1.00
multifaceted	UTSW	11	80693072	missense	probably damaging	1.00
whisper	UTSW	11	80484332	missense	probably damaging	0.99
whisper2	UTSW	11	80666578	missense	probably damaging	1.00
whisper3	UTSW	11	80557521	missense	probably damaging	1.00
R0069:Myo1d	UTSW	11	80637953	missense	probably damaging	1.00
R0069:Myo1d	UTSW	11	80637953	missense	probably damaging	1.00
R0081:Myo1d	UTSW	11	80557523	missense	probably benign	0.00
R0096:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0096:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0244:Myo1d	UTSW	11	80674708	missense	probably damaging	1.00
R0711:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0746:Myo1d	UTSW	11	80586879	missense	possibly damaging	0.94
R1084:Myo1d	UTSW	11	80684395	missense	probably damaging	1.00
R1514:Myo1d	UTSW	11	80685908	missense	probably damaging	0.97
R1676:Myo1d	UTSW	11	80684421	missense	probably damaging	1.00
R1862:Myo1d	UTSW	11	80663048	missense	probably damaging	1.00
R2497:Myo1d	UTSW	11	80674821	missense	probably damaging	1.00
R2512:Myo1d	UTSW	11	80779717	missense	probably benign	0.00
R3425:Myo1d	UTSW	11	80601638	missense	probably benign
R3429:Myo1d	UTSW	11	80682410	missense	probably damaging	1.00
R3917:Myo1d	UTSW	11	80666578	missense	probably damaging	1.00
R3928:Myo1d	UTSW	11	80484261	missense	probably benign	0.09
R4706:Myo1d	UTSW	11	80666641	missense	probably damaging	0.96
R4723:Myo1d	UTSW	11	80779841	utr 5 prime	probably benign
R4924:Myo1d	UTSW	11	80674678	missense	probably damaging	1.00
R5042:Myo1d	UTSW	11	80557521	missense	probably damaging	1.00
R5320:Myo1d	UTSW	11	80684323	critical splice donor site	probably null
R5481:Myo1d	UTSW	11	80663095	missense	possibly damaging	0.79
R6214:Myo1d	UTSW	11	80779791	start codon destroyed	probably null	0.98
R6235:Myo1d	UTSW	11	80692944	missense	probably benign	0.23
R6282:Myo1d	UTSW	11	80557512	missense	probably damaging	0.99
R6468:Myo1d	UTSW	11	80557474	missense	probably benign	0.00
R6668:Myo1d	UTSW	11	80583875	intron	probably benign
R6954:Myo1d	UTSW	11	80674957	missense	probably benign	0.21
R7078:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7080:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7172:Myo1d	UTSW	11	80592795	missense	probably benign	0.16
R7276:Myo1d	UTSW	11	80693072	missense	probably damaging	1.00
R7467:Myo1d	UTSW	11	80586917	missense	probably damaging	1.00
R7650:Myo1d	UTSW	11	80601684	missense	probably benign
R7678:Myo1d	UTSW	11	80676893	missense	possibly damaging	0.80
R7859:Myo1d	UTSW	11	80684377	missense	probably damaging	1.00
R8324:Myo1d	UTSW	11	80557521	missense	probably damaging	1.00
R8329:Myo1d	UTSW	11	80638074	missense	probably benign	0.21
R8474:Myo1d	UTSW	11	80670919	missense	possibly damaging	0.93
R8799:Myo1d	UTSW	11	80684379	missense	probably damaging	1.00
R8810:Myo1d	UTSW	11	80674932	missense	probably damaging	1.00
R8810:Myo1d	UTSW	11	80676932	missense	probably benign	0.30
R8823:Myo1d	UTSW	11	80601745	missense	possibly damaging	0.91
R9221:Myo1d	UTSW	11	80674918	missense	probably damaging	1.00
R9494:Myo1d	UTSW	11	80484267	missense	probably benign	0.02
R9625:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
R9626:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
R9628:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
Z1088:Myo1d	UTSW	11	80674898	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGGGAATGACTCCTCTCCAG -3'
(R):5'- ATGACACCACGATACATGGG -3'

Sequencing Primer
(F):5'- AACAACTGAGTCGGGAAATAAGTTC -3'
(R):5'- GAAAAACACGGTTATTGGTGTCTTG -3'

Posted On

2019-05-15