Incidental Mutation 'R7077:Adam21'
ID549290
Institutional Source Beutler Lab
Gene Symbol Adam21
Ensembl Gene ENSMUSG00000008438
Gene Namea disintegrin and metallopeptidase domain 21
SynonymsADAM31
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7077 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location81558584-81568474 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 81559119 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 623 (C623Y)
Ref Sequence ENSEMBL: ENSMUSP00000008582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008582]
Predicted Effect probably damaging
Transcript: ENSMUST00000008582
AA Change: C623Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000008582
Gene: ENSMUSG00000008438
AA Change: C623Y

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 164 5.1e-21 PFAM
Pfam:Reprolysin_4 212 389 2.5e-11 PFAM
Pfam:Reprolysin 212 402 7.3e-50 PFAM
Pfam:Reprolysin_5 214 400 5.8e-19 PFAM
Pfam:Reprolysin_2 233 393 1.3e-14 PFAM
Pfam:Reprolysin_3 236 356 6.5e-16 PFAM
DISIN 419 494 2.45e-37 SMART
ACR 495 631 6.49e-62 SMART
EGF 637 667 2.03e1 SMART
transmembrane domain 687 709 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. The encoded protein functions in the regulation of spermatogenesis in the testes and neurogenesis in the central nervous system. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago3 T C 4: 126,371,532 K322R probably null Het
Ankrd17 T C 5: 90,285,864 H682R possibly damaging Het
Aoah A G 13: 20,910,106 D187G probably damaging Het
Arhgap17 T C 7: 123,280,008 D840G unknown Het
AW551984 C T 9: 39,591,427 V650I probably benign Het
BC051142 C A 17: 34,440,882 T93N possibly damaging Het
Bok T A 1: 93,689,189 Y86N probably damaging Het
Ccdc146 T A 5: 21,305,274 N580I possibly damaging Het
Ccng2 T C 5: 93,269,340 S72P possibly damaging Het
Cfap74 T G 4: 155,455,677 I977S unknown Het
Cobl T C 11: 12,253,441 N1087S probably benign Het
Cyp21a1 C A 17: 34,802,359 R346L probably damaging Het
Eif4a1 A C 11: 69,670,664 F52L probably damaging Het
Eif4ebp2 A C 10: 61,433,801 I120S probably damaging Het
Enpp2 A C 15: 54,901,391 D146E probably benign Het
Exosc9 T C 3: 36,553,056 Y30H probably damaging Het
Fam117a G A 11: 95,377,672 G300S probably benign Het
Focad C A 4: 88,410,677 A1709E unknown Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Fsip2 T C 2: 82,983,152 F3272L probably benign Het
Gcnt2 G A 13: 40,860,420 M22I probably benign Het
Gjd4 T C 18: 9,280,928 E50G probably damaging Het
Gm10375 G T 14: 43,602,970 T162K probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gm4924 T C 10: 82,379,223 F952L unknown Het
Heatr1 T C 13: 12,418,164 F1132L possibly damaging Het
Hnrnpu A G 1: 178,332,191 Y442H unknown Het
Hp1bp3 C A 4: 138,239,618 T408N probably damaging Het
Htra3 A G 5: 35,668,316 V198A probably damaging Het
Katnal1 T C 5: 148,891,737 T300A probably benign Het
Lipo5 G T 19: 33,467,770 P133Q Het
Lrp1b A T 2: 41,770,846 H197Q Het
Mdc1 C A 17: 35,845,947 A82D probably damaging Het
Mstn A T 1: 53,064,249 D248V probably benign Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Ola1 G A 2: 73,141,964 T221I probably damaging Het
Olfr1086 T C 2: 86,676,892 Y147C possibly damaging Het
Olfr67 A G 7: 103,787,386 I297T probably damaging Het
Olfr857 T A 9: 19,713,132 S102T probably benign Het
Olfr898 T A 9: 38,349,970 Y290N probably damaging Het
Phldb1 T C 9: 44,711,904 T618A possibly damaging Het
Pkd1 T G 17: 24,591,119 W3565G probably damaging Het
Prl3a1 A T 13: 27,276,103 N190I probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn11 C T 5: 121,143,570 R484Q probably benign Het
Rapgef4 T C 2: 72,241,476 M900T probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Smarcd3 G T 5: 24,594,962 A270D probably damaging Het
Srgap2 A G 1: 131,344,449 M33T Het
Tle1 G C 4: 72,158,375 P139A probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Zfp658 T A 7: 43,573,989 S563T probably benign Het
Zswim9 G A 7: 13,259,752 R826C probably damaging Het
Other mutations in Adam21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02186:Adam21 APN 12 81559209 missense possibly damaging 0.61
IGL02311:Adam21 APN 12 81560892 missense probably benign 0.01
IGL03132:Adam21 APN 12 81560374 nonsense probably null
IGL03225:Adam21 APN 12 81559269 missense probably benign 0.00
R0305:Adam21 UTSW 12 81560285 missense possibly damaging 0.96
R0634:Adam21 UTSW 12 81560352 missense probably benign 0.01
R1415:Adam21 UTSW 12 81559547 nonsense probably null
R1961:Adam21 UTSW 12 81559508 nonsense probably null
R1996:Adam21 UTSW 12 81559602 missense possibly damaging 0.79
R2159:Adam21 UTSW 12 81560467 missense probably benign 0.17
R2215:Adam21 UTSW 12 81560290 missense probably damaging 1.00
R3780:Adam21 UTSW 12 81559273 missense probably damaging 1.00
R3964:Adam21 UTSW 12 81560809 missense possibly damaging 0.46
R4356:Adam21 UTSW 12 81558820 missense probably damaging 0.99
R4503:Adam21 UTSW 12 81560898 missense probably benign
R4795:Adam21 UTSW 12 81560974 missense probably benign 0.06
R4925:Adam21 UTSW 12 81560389 missense probably benign
R4932:Adam21 UTSW 12 81558918 missense probably benign 0.14
R5110:Adam21 UTSW 12 81560215 missense probably benign 0.40
R5831:Adam21 UTSW 12 81559101 missense probably benign 0.06
R6289:Adam21 UTSW 12 81560706 missense probably damaging 1.00
R6500:Adam21 UTSW 12 81559606 missense probably benign 0.01
R7083:Adam21 UTSW 12 81560241 missense possibly damaging 0.81
R7173:Adam21 UTSW 12 81559234 missense probably benign 0.24
R7176:Adam21 UTSW 12 81560248 missense possibly damaging 0.94
R7232:Adam21 UTSW 12 81560556 missense probably damaging 0.99
R7371:Adam21 UTSW 12 81560290 missense probably damaging 1.00
R7486:Adam21 UTSW 12 81558883 missense probably benign 0.00
R7522:Adam21 UTSW 12 81558948 missense possibly damaging 0.78
R8040:Adam21 UTSW 12 81560437 missense not run
Z1088:Adam21 UTSW 12 81560686 missense probably damaging 1.00
Z1176:Adam21 UTSW 12 81559743 missense not run
Predicted Primers PCR Primer
(F):5'- TGGACCACTGTCAATACTACCTC -3'
(R):5'- AACAGGTTTGGCCATTGTGG -3'

Sequencing Primer
(F):5'- TCCATAACCTCTGTGCAGGCAG -3'
(R):5'- GGCACAGTATTCCTAAAATGCAG -3'
Posted On2019-05-15