Incidental Mutation 'R7077:Gcnt2'
ID549294
Institutional Source Beutler Lab
Gene Symbol Gcnt2
Ensembl Gene ENSMUSG00000021360
Gene Nameglucosaminyl (N-acetyl) transferase 2, I-branching enzyme
SynonymsIGnTB, IGnT, IGnTA, IGnTC, 5330430K10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R7077 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location40859754-40960892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40860420 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 22 (M22I)
Ref Sequence ENSEMBL: ENSMUSP00000105820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110191]
Predicted Effect probably benign
Transcript: ENSMUST00000110191
AA Change: M22I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105820
Gene: ENSMUSG00000021360
AA Change: M22I

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Branch 95 357 5.2e-61 PFAM
low complexity region 377 386 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for formation of the blood group I antigen. The i and I antigens are distinguished by linear and branched poly-N-acetyllactosaminoglycans, respectively. The encoded protein is the I-branching enzyme, a beta-1,6-N-acetylglucosaminyltransferase responsible for the conversion of fetal i antigen to adult I antigen in erythrocytes during embryonic development. Mutations in this gene have been associated with adult i blood group phenotype. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show hypoactivity, a reduced B cell number, epidermoid cyst formation in male abdominal skin, and impaired renal function with increased blood urea nitrogen and creatinine levels and vacuolization of renal tubular epithelial cells in aging mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 C T 12: 81,559,119 C623Y probably damaging Het
Ago3 T C 4: 126,371,532 K322R probably null Het
Ankrd17 T C 5: 90,285,864 H682R possibly damaging Het
Aoah A G 13: 20,910,106 D187G probably damaging Het
Arhgap17 T C 7: 123,280,008 D840G unknown Het
AW551984 C T 9: 39,591,427 V650I probably benign Het
BC051142 C A 17: 34,440,882 T93N possibly damaging Het
Bok T A 1: 93,689,189 Y86N probably damaging Het
Ccdc146 T A 5: 21,305,274 N580I possibly damaging Het
Ccng2 T C 5: 93,269,340 S72P possibly damaging Het
Cfap74 T G 4: 155,455,677 I977S unknown Het
Cobl T C 11: 12,253,441 N1087S probably benign Het
Cyp21a1 C A 17: 34,802,359 R346L probably damaging Het
Eif4a1 A C 11: 69,670,664 F52L probably damaging Het
Eif4ebp2 A C 10: 61,433,801 I120S probably damaging Het
Enpp2 A C 15: 54,901,391 D146E probably benign Het
Exosc9 T C 3: 36,553,056 Y30H probably damaging Het
Fam117a G A 11: 95,377,672 G300S probably benign Het
Focad C A 4: 88,410,677 A1709E unknown Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Fsip2 T C 2: 82,983,152 F3272L probably benign Het
Gjd4 T C 18: 9,280,928 E50G probably damaging Het
Gm10375 G T 14: 43,602,970 T162K probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gm4924 T C 10: 82,379,223 F952L unknown Het
Heatr1 T C 13: 12,418,164 F1132L possibly damaging Het
Hnrnpu A G 1: 178,332,191 Y442H unknown Het
Hp1bp3 C A 4: 138,239,618 T408N probably damaging Het
Htra3 A G 5: 35,668,316 V198A probably damaging Het
Katnal1 T C 5: 148,891,737 T300A probably benign Het
Lipo5 G T 19: 33,467,770 P133Q Het
Lrp1b A T 2: 41,770,846 H197Q Het
Mdc1 C A 17: 35,845,947 A82D probably damaging Het
Mstn A T 1: 53,064,249 D248V probably benign Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Ola1 G A 2: 73,141,964 T221I probably damaging Het
Olfr1086 T C 2: 86,676,892 Y147C possibly damaging Het
Olfr67 A G 7: 103,787,386 I297T probably damaging Het
Olfr857 T A 9: 19,713,132 S102T probably benign Het
Olfr898 T A 9: 38,349,970 Y290N probably damaging Het
Phldb1 T C 9: 44,711,904 T618A possibly damaging Het
Pkd1 T G 17: 24,591,119 W3565G probably damaging Het
Prl3a1 A T 13: 27,276,103 N190I probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn11 C T 5: 121,143,570 R484Q probably benign Het
Rapgef4 T C 2: 72,241,476 M900T probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Smarcd3 G T 5: 24,594,962 A270D probably damaging Het
Srgap2 A G 1: 131,344,449 M33T Het
Tle1 G C 4: 72,158,375 P139A probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Zfp658 T A 7: 43,573,989 S563T probably benign Het
Zswim9 G A 7: 13,259,752 R826C probably damaging Het
Other mutations in Gcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Gcnt2 APN 13 40887863 missense probably benign 0.06
IGL01693:Gcnt2 APN 13 40888073 missense probably benign
IGL02506:Gcnt2 APN 13 40887380 missense probably benign 0.02
IGL03184:Gcnt2 APN 13 40888184 missense probably benign 0.01
BB001:Gcnt2 UTSW 13 40918564 nonsense probably null
BB011:Gcnt2 UTSW 13 40918564 nonsense probably null
PIT4472001:Gcnt2 UTSW 13 40917937 missense probably benign 0.39
R0358:Gcnt2 UTSW 13 40860853 missense probably damaging 0.99
R0734:Gcnt2 UTSW 13 40860521 missense probably benign 0.00
R1863:Gcnt2 UTSW 13 40861101 missense possibly damaging 0.95
R3103:Gcnt2 UTSW 13 40918606 missense probably benign 0.00
R3156:Gcnt2 UTSW 13 40861178 missense probably benign 0.36
R3893:Gcnt2 UTSW 13 40860446 missense probably benign 0.14
R4134:Gcnt2 UTSW 13 40887807 missense probably damaging 1.00
R4135:Gcnt2 UTSW 13 40887807 missense probably damaging 1.00
R4279:Gcnt2 UTSW 13 40888190 missense probably benign 0.17
R4422:Gcnt2 UTSW 13 40860525 nonsense probably null
R4599:Gcnt2 UTSW 13 40887490 missense probably benign
R4618:Gcnt2 UTSW 13 40958194 nonsense probably null
R4908:Gcnt2 UTSW 13 40860734 missense probably damaging 1.00
R5123:Gcnt2 UTSW 13 40918355 missense probably damaging 0.99
R5291:Gcnt2 UTSW 13 40918792 missense probably damaging 1.00
R5437:Gcnt2 UTSW 13 40861176 missense probably damaging 1.00
R5463:Gcnt2 UTSW 13 40918174 missense possibly damaging 0.80
R5471:Gcnt2 UTSW 13 40860719 missense probably damaging 1.00
R5472:Gcnt2 UTSW 13 40953579 missense probably benign 0.30
R5493:Gcnt2 UTSW 13 40953600 missense possibly damaging 0.70
R5586:Gcnt2 UTSW 13 40860953 missense probably damaging 1.00
R5695:Gcnt2 UTSW 13 40918199 missense probably benign 0.03
R6244:Gcnt2 UTSW 13 40861241 missense probably damaging 1.00
R6293:Gcnt2 UTSW 13 40918697 missense probably damaging 1.00
R7036:Gcnt2 UTSW 13 40887556 frame shift probably null
R7432:Gcnt2 UTSW 13 40887212 intron probably benign
R7474:Gcnt2 UTSW 13 40958257 missense probably damaging 1.00
R7508:Gcnt2 UTSW 13 40887681 missense probably benign 0.02
R7599:Gcnt2 UTSW 13 40860867 nonsense probably null
R7678:Gcnt2 UTSW 13 40953719 missense probably benign 0.01
R7806:Gcnt2 UTSW 13 40918241 missense probably damaging 1.00
R7808:Gcnt2 UTSW 13 40860862 missense possibly damaging 0.81
R7909:Gcnt2 UTSW 13 40860450 missense probably benign 0.00
R7924:Gcnt2 UTSW 13 40918564 nonsense probably null
R8110:Gcnt2 UTSW 13 40917722 start gained probably benign
R8287:Gcnt2 UTSW 13 40860632 missense probably damaging 1.00
Z1088:Gcnt2 UTSW 13 40918639 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGAGCCAAGGAGCTTTGC -3'
(R):5'- AAGCGGGCTTCTTCTTCAGAG -3'

Sequencing Primer
(F):5'- ATCAGAGCCTCATCCGTGC -3'
(R):5'- GGCTTCTTCTTCAGAGAGAGTCTC -3'
Posted On2019-05-15