Incidental Mutation 'R7077:Tmem161b'
ID549295
Institutional Source Beutler Lab
Gene Symbol Tmem161b
Ensembl Gene ENSMUSG00000035762
Gene Nametransmembrane protein 161B
Synonyms2810446P07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7077 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location84222296-84296141 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to A at 84222418 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057495] [ENSMUST00000223827] [ENSMUST00000223862] [ENSMUST00000224525] [ENSMUST00000225069]
Predicted Effect probably benign
Transcript: ENSMUST00000057495
SMART Domains Protein: ENSMUSP00000055208
Gene: ENSMUSG00000035762

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 2 485 1.3e-213 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185973
Predicted Effect probably benign
Transcript: ENSMUST00000223827
Predicted Effect probably benign
Transcript: ENSMUST00000223862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224501
Predicted Effect probably benign
Transcript: ENSMUST00000224525
Predicted Effect probably benign
Transcript: ENSMUST00000225069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225212
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Homozygous mice exhibit lethality before genotyping age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 C T 12: 81,559,119 C623Y probably damaging Het
Ago3 T C 4: 126,371,532 K322R probably null Het
Ankrd17 T C 5: 90,285,864 H682R possibly damaging Het
Aoah A G 13: 20,910,106 D187G probably damaging Het
Arhgap17 T C 7: 123,280,008 D840G unknown Het
AW551984 C T 9: 39,591,427 V650I probably benign Het
BC051142 C A 17: 34,440,882 T93N possibly damaging Het
Bok T A 1: 93,689,189 Y86N probably damaging Het
Ccdc146 T A 5: 21,305,274 N580I possibly damaging Het
Ccng2 T C 5: 93,269,340 S72P possibly damaging Het
Cfap74 T G 4: 155,455,677 I977S unknown Het
Cobl T C 11: 12,253,441 N1087S probably benign Het
Cyp21a1 C A 17: 34,802,359 R346L probably damaging Het
Eif4a1 A C 11: 69,670,664 F52L probably damaging Het
Eif4ebp2 A C 10: 61,433,801 I120S probably damaging Het
Enpp2 A C 15: 54,901,391 D146E probably benign Het
Exosc9 T C 3: 36,553,056 Y30H probably damaging Het
Fam117a G A 11: 95,377,672 G300S probably benign Het
Focad C A 4: 88,410,677 A1709E unknown Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Fsip2 T C 2: 82,983,152 F3272L probably benign Het
Gcnt2 G A 13: 40,860,420 M22I probably benign Het
Gjd4 T C 18: 9,280,928 E50G probably damaging Het
Gm10375 G T 14: 43,602,970 T162K probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gm4924 T C 10: 82,379,223 F952L unknown Het
Heatr1 T C 13: 12,418,164 F1132L possibly damaging Het
Hnrnpu A G 1: 178,332,191 Y442H unknown Het
Hp1bp3 C A 4: 138,239,618 T408N probably damaging Het
Htra3 A G 5: 35,668,316 V198A probably damaging Het
Katnal1 T C 5: 148,891,737 T300A probably benign Het
Lipo5 G T 19: 33,467,770 P133Q Het
Lrp1b A T 2: 41,770,846 H197Q Het
Mdc1 C A 17: 35,845,947 A82D probably damaging Het
Mstn A T 1: 53,064,249 D248V probably benign Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Ola1 G A 2: 73,141,964 T221I probably damaging Het
Olfr1086 T C 2: 86,676,892 Y147C possibly damaging Het
Olfr67 A G 7: 103,787,386 I297T probably damaging Het
Olfr857 T A 9: 19,713,132 S102T probably benign Het
Olfr898 T A 9: 38,349,970 Y290N probably damaging Het
Phldb1 T C 9: 44,711,904 T618A possibly damaging Het
Pkd1 T G 17: 24,591,119 W3565G probably damaging Het
Prl3a1 A T 13: 27,276,103 N190I probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn11 C T 5: 121,143,570 R484Q probably benign Het
Rapgef4 T C 2: 72,241,476 M900T probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Smarcd3 G T 5: 24,594,962 A270D probably damaging Het
Srgap2 A G 1: 131,344,449 M33T Het
Tle1 G C 4: 72,158,375 P139A probably benign Het
Zfp658 T A 7: 43,573,989 S563T probably benign Het
Zswim9 G A 7: 13,259,752 R826C probably damaging Het
Other mutations in Tmem161b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Tmem161b APN 13 84294596 splice site probably benign
IGL01086:Tmem161b APN 13 84222422 utr 5 prime probably benign
IGL01150:Tmem161b APN 13 84292407 nonsense probably null
IGL01566:Tmem161b APN 13 84294762 missense probably benign 0.35
IGL02183:Tmem161b APN 13 84272254 missense probably damaging 1.00
IGL02481:Tmem161b APN 13 84283993 missense probably damaging 0.99
IGL02519:Tmem161b APN 13 84294744 missense probably damaging 1.00
IGL03207:Tmem161b APN 13 84294595 splice site probably benign
R6836_Tmem161b_587 UTSW 13 84222418 start gained probably benign
R0015:Tmem161b UTSW 13 84222414 utr 5 prime probably null
R0376:Tmem161b UTSW 13 84292383 missense probably benign 0.43
R0613:Tmem161b UTSW 13 84251320 missense probably damaging 1.00
R1925:Tmem161b UTSW 13 84260229 missense probably benign 0.07
R1935:Tmem161b UTSW 13 84293466 missense probably damaging 1.00
R1936:Tmem161b UTSW 13 84293466 missense probably damaging 1.00
R2325:Tmem161b UTSW 13 84294768 missense possibly damaging 0.94
R2988:Tmem161b UTSW 13 84292455 nonsense probably null
R4327:Tmem161b UTSW 13 84251240 missense probably damaging 1.00
R4525:Tmem161b UTSW 13 84257802 missense probably benign 0.00
R4558:Tmem161b UTSW 13 84251244 missense possibly damaging 0.50
R5133:Tmem161b UTSW 13 84294768 missense possibly damaging 0.94
R5134:Tmem161b UTSW 13 84294768 missense possibly damaging 0.94
R5727:Tmem161b UTSW 13 84286790 missense possibly damaging 0.63
R5875:Tmem161b UTSW 13 84294858 missense probably damaging 1.00
R6217:Tmem161b UTSW 13 84251244 missense possibly damaging 0.50
R6527:Tmem161b UTSW 13 84272264 missense probably benign 0.06
R6550:Tmem161b UTSW 13 84222418 start gained probably benign
R6551:Tmem161b UTSW 13 84222418 start gained probably benign
R6553:Tmem161b UTSW 13 84222418 start gained probably benign
R6554:Tmem161b UTSW 13 84222418 start gained probably benign
R6640:Tmem161b UTSW 13 84222418 start gained probably benign
R6641:Tmem161b UTSW 13 84222418 start gained probably benign
R6685:Tmem161b UTSW 13 84222418 start gained probably benign
R6836:Tmem161b UTSW 13 84222418 start gained probably benign
R6837:Tmem161b UTSW 13 84222418 start gained probably benign
R6838:Tmem161b UTSW 13 84222418 start gained probably benign
R7078:Tmem161b UTSW 13 84222418 start gained probably benign
R7386:Tmem161b UTSW 13 84222418 start gained probably benign
R7388:Tmem161b UTSW 13 84222418 start gained probably benign
R7429:Tmem161b UTSW 13 84282747 critical splice acceptor site probably null
R7430:Tmem161b UTSW 13 84282747 critical splice acceptor site probably null
R7547:Tmem161b UTSW 13 84222418 start gained probably benign
R7548:Tmem161b UTSW 13 84222418 start gained probably benign
R7634:Tmem161b UTSW 13 84222418 start gained probably benign
R7636:Tmem161b UTSW 13 84222418 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GGCTTTAGAGAACGCCTTGC -3'
(R):5'- TAGACTGGGTACTCCGACAGAC -3'

Sequencing Primer
(F):5'- TCCTCTCTGCGTGGCGTG -3'
(R):5'- TCCCTCGGCTGTCTGGAAC -3'
Posted On2019-05-15