Incidental Mutation 'R7077:Enpp2'
ID549298
Institutional Source Beutler Lab
Gene Symbol Enpp2
Ensembl Gene ENSMUSG00000022425
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 2
SynonymsPdnp2, Npps2, PD-Ialpha, ATX, Autotaxin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7077 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location54838901-54952892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 54901391 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 146 (D146E)
Ref Sequence ENSEMBL: ENSMUSP00000128941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041591] [ENSMUST00000167541] [ENSMUST00000171545] [ENSMUST00000173516] [ENSMUST00000228222]
PDB Structure Crystal structure of mouse autotaxin [X-RAY DIFFRACTION]
Crystal structure of mouse autotaxin in complex with 14:0-LPA [X-RAY DIFFRACTION]
Crystal structure of mouse autotaxin in complex with 16:0-LPA [X-RAY DIFFRACTION]
Crystal structure of mouse autotaxin in complex with 18:1-LPA [X-RAY DIFFRACTION]
Crystal structure of mouse autotaxin in complex with 18:3-LPA [X-RAY DIFFRACTION]
Crystal structure of mouse autotaxin in complex with 22:6-LPA [X-RAY DIFFRACTION]
Crystal Structure of Autotaxin in Complex with Compound 10 [X-RAY DIFFRACTION]
Crystal Structure of Autotaxin in Complex with 2BoA [X-RAY DIFFRACTION]
Crystal Structure of Autotaxin in Complex with 3BoA [X-RAY DIFFRACTION]
Crystal Structure of Autotaxin in Complex with 4BoA [X-RAY DIFFRACTION]
>> 4 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000041591
AA Change: D146E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000036180
Gene: ENSMUSG00000022425
AA Change: D146E

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 285 4.7e-41 PFAM
Pfam:Phosphodiest 278 477 3.3e-40 PFAM
Endonuclease_NS 613 844 3.93e-36 SMART
NUC 614 844 1.32e-109 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167541
AA Change: D146E

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132640
Gene: ENSMUSG00000022425
AA Change: D146E

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 284 5.4e-41 PFAM
Pfam:Phosphodiest 278 477 3.4e-40 PFAM
Endonuclease_NS 638 869 3.93e-36 SMART
NUC 639 869 1.32e-109 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171545
AA Change: D146E

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128941
Gene: ENSMUSG00000022425
AA Change: D146E

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 283 2.8e-43 PFAM
Pfam:Phosphodiest 275 529 2.8e-36 PFAM
Endonuclease_NS 665 896 3.93e-36 SMART
NUC 666 896 1.32e-109 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173516
AA Change: D146E

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133877
Gene: ENSMUSG00000022425
AA Change: D146E

DomainStartEndE-ValueType
SO 54 97 4.79e-16 SMART
SO 98 141 2.95e-16 SMART
Pfam:Phosphodiest 165 285 2.8e-41 PFAM
Pfam:Phosphodiest 276 529 7.8e-36 PFAM
Endonuclease_NS 661 892 3.93e-36 SMART
NUC 662 892 1.32e-109 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228222
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: This gene encodes a member of the phosphodiesterase and nucleotide pyrophosphatase family of bifunctional enzymes that hydrolize phosphodiester bonds of various nucleotides. The encoded protein undergoes proteolytic processing to generate a mature protein with lysophospholipase D activity, catalyzing the cleavage of the choline group from lysophosphatidylcholine to produce lysophosphatidic acid. This gene is expressed in numerous tissues and participates in neural development, obesity, inflammation and oncogenesis. A complete lack of the encoded protein in mice results in aberrant vascular and neuronal development leading to embryonic lethality. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, absent yolk sac vasculature, abnormal vasculature, and variable penetrance of impaired embryo turning, edema, failure of chorioallantoic fusion, neural tube malformations, and abnormal forebrain development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 C T 12: 81,559,119 C623Y probably damaging Het
Ago3 T C 4: 126,371,532 K322R probably null Het
Ankrd17 T C 5: 90,285,864 H682R possibly damaging Het
Aoah A G 13: 20,910,106 D187G probably damaging Het
Arhgap17 T C 7: 123,280,008 D840G unknown Het
AW551984 C T 9: 39,591,427 V650I probably benign Het
BC051142 C A 17: 34,440,882 T93N possibly damaging Het
Bok T A 1: 93,689,189 Y86N probably damaging Het
Ccdc146 T A 5: 21,305,274 N580I possibly damaging Het
Ccng2 T C 5: 93,269,340 S72P possibly damaging Het
Cfap74 T G 4: 155,455,677 I977S unknown Het
Cobl T C 11: 12,253,441 N1087S probably benign Het
Cyp21a1 C A 17: 34,802,359 R346L probably damaging Het
Eif4a1 A C 11: 69,670,664 F52L probably damaging Het
Eif4ebp2 A C 10: 61,433,801 I120S probably damaging Het
Exosc9 T C 3: 36,553,056 Y30H probably damaging Het
Fam117a G A 11: 95,377,672 G300S probably benign Het
Focad C A 4: 88,410,677 A1709E unknown Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Fsip2 T C 2: 82,983,152 F3272L probably benign Het
Gcnt2 G A 13: 40,860,420 M22I probably benign Het
Gjd4 T C 18: 9,280,928 E50G probably damaging Het
Gm10375 G T 14: 43,602,970 T162K probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gm4924 T C 10: 82,379,223 F952L unknown Het
Heatr1 T C 13: 12,418,164 F1132L possibly damaging Het
Hnrnpu A G 1: 178,332,191 Y442H unknown Het
Hp1bp3 C A 4: 138,239,618 T408N probably damaging Het
Htra3 A G 5: 35,668,316 V198A probably damaging Het
Katnal1 T C 5: 148,891,737 T300A probably benign Het
Lipo5 G T 19: 33,467,770 P133Q Het
Lrp1b A T 2: 41,770,846 H197Q Het
Mdc1 C A 17: 35,845,947 A82D probably damaging Het
Mstn A T 1: 53,064,249 D248V probably benign Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Ola1 G A 2: 73,141,964 T221I probably damaging Het
Olfr1086 T C 2: 86,676,892 Y147C possibly damaging Het
Olfr67 A G 7: 103,787,386 I297T probably damaging Het
Olfr857 T A 9: 19,713,132 S102T probably benign Het
Olfr898 T A 9: 38,349,970 Y290N probably damaging Het
Phldb1 T C 9: 44,711,904 T618A possibly damaging Het
Pkd1 T G 17: 24,591,119 W3565G probably damaging Het
Prl3a1 A T 13: 27,276,103 N190I probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn11 C T 5: 121,143,570 R484Q probably benign Het
Rapgef4 T C 2: 72,241,476 M900T probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Smarcd3 G T 5: 24,594,962 A270D probably damaging Het
Srgap2 A G 1: 131,344,449 M33T Het
Tle1 G C 4: 72,158,375 P139A probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Zfp658 T A 7: 43,573,989 S563T probably benign Het
Zswim9 G A 7: 13,259,752 R826C probably damaging Het
Other mutations in Enpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Enpp2 APN 15 54875650 critical splice donor site probably null
IGL01290:Enpp2 APN 15 54919602 missense possibly damaging 0.79
IGL01296:Enpp2 APN 15 54875669 missense probably damaging 1.00
IGL01650:Enpp2 APN 15 54919933 missense probably benign
IGL02470:Enpp2 APN 15 54839460 missense probably damaging 1.00
IGL02522:Enpp2 APN 15 54898940 missense probably damaging 0.99
IGL02727:Enpp2 APN 15 54910181 missense probably damaging 1.00
IGL03178:Enpp2 APN 15 54866006 missense probably benign
IGL03055:Enpp2 UTSW 15 54866085 splice site probably null
PIT4260001:Enpp2 UTSW 15 54844378 critical splice donor site probably null
R0302:Enpp2 UTSW 15 54860061 missense probably benign 0.15
R0304:Enpp2 UTSW 15 54877806 missense probably benign 0.07
R0385:Enpp2 UTSW 15 54882159 missense probably damaging 1.00
R0440:Enpp2 UTSW 15 54847237 splice site probably benign
R0696:Enpp2 UTSW 15 54897696 nonsense probably null
R0879:Enpp2 UTSW 15 54877930 missense probably damaging 0.98
R0924:Enpp2 UTSW 15 54906959 splice site probably benign
R0989:Enpp2 UTSW 15 54875759 missense possibly damaging 0.88
R1126:Enpp2 UTSW 15 54906826 critical splice donor site probably null
R1434:Enpp2 UTSW 15 54862681 missense probably damaging 1.00
R1447:Enpp2 UTSW 15 54919598 critical splice donor site probably null
R1464:Enpp2 UTSW 15 54863812 missense probably damaging 1.00
R1464:Enpp2 UTSW 15 54863812 missense probably damaging 1.00
R1501:Enpp2 UTSW 15 54839514 missense probably damaging 1.00
R1546:Enpp2 UTSW 15 54845829 missense probably benign 0.01
R1673:Enpp2 UTSW 15 54910196 splice site probably null
R1853:Enpp2 UTSW 15 54845823 missense probably damaging 1.00
R1854:Enpp2 UTSW 15 54845823 missense probably damaging 1.00
R1855:Enpp2 UTSW 15 54845823 missense probably damaging 1.00
R1969:Enpp2 UTSW 15 54882982 missense probably damaging 1.00
R1970:Enpp2 UTSW 15 54882982 missense probably damaging 1.00
R2060:Enpp2 UTSW 15 54875714 missense probably damaging 1.00
R2122:Enpp2 UTSW 15 54897792 nonsense probably null
R2275:Enpp2 UTSW 15 54897794 missense probably damaging 1.00
R2517:Enpp2 UTSW 15 54919694 missense probably damaging 0.99
R3881:Enpp2 UTSW 15 54919692 missense probably damaging 1.00
R3934:Enpp2 UTSW 15 54845921 missense probably benign 0.03
R4722:Enpp2 UTSW 15 54887589 missense probably damaging 0.99
R4765:Enpp2 UTSW 15 54875672 missense possibly damaging 0.91
R4799:Enpp2 UTSW 15 54910094 missense probably damaging 1.00
R4934:Enpp2 UTSW 15 54882147 missense probably damaging 1.00
R4976:Enpp2 UTSW 15 54870305 nonsense probably null
R5068:Enpp2 UTSW 15 54864054 missense probably damaging 1.00
R5069:Enpp2 UTSW 15 54864054 missense probably damaging 1.00
R5070:Enpp2 UTSW 15 54864054 missense probably damaging 1.00
R5119:Enpp2 UTSW 15 54870305 nonsense probably null
R5134:Enpp2 UTSW 15 54899330 missense probably damaging 1.00
R5162:Enpp2 UTSW 15 54847296 missense probably benign 0.06
R5218:Enpp2 UTSW 15 54887586 missense possibly damaging 0.86
R5415:Enpp2 UTSW 15 54882156 missense probably damaging 1.00
R5965:Enpp2 UTSW 15 54882971 critical splice donor site probably null
R6086:Enpp2 UTSW 15 54845834 missense probably damaging 1.00
R6229:Enpp2 UTSW 15 54877832 missense probably damaging 1.00
R6306:Enpp2 UTSW 15 54899346 missense probably damaging 1.00
R6314:Enpp2 UTSW 15 54865970 missense probably damaging 0.99
R6403:Enpp2 UTSW 15 54863764 missense probably damaging 1.00
R6515:Enpp2 UTSW 15 54860093 missense possibly damaging 0.75
R6525:Enpp2 UTSW 15 54870211 missense probably benign 0.01
R6536:Enpp2 UTSW 15 54862631 missense probably damaging 1.00
R7070:Enpp2 UTSW 15 54899289 missense probably damaging 1.00
R7265:Enpp2 UTSW 15 54910033 critical splice donor site probably null
R7324:Enpp2 UTSW 15 54877774 critical splice donor site probably null
R7331:Enpp2 UTSW 15 54875670 missense probably damaging 1.00
R7452:Enpp2 UTSW 15 54866736 missense probably damaging 0.99
R7494:Enpp2 UTSW 15 54910158 missense probably damaging 1.00
R7557:Enpp2 UTSW 15 54910140 missense probably damaging 1.00
R7574:Enpp2 UTSW 15 54851417 missense probably benign
R7665:Enpp2 UTSW 15 54839394 missense probably damaging 0.98
R7744:Enpp2 UTSW 15 54901233 splice site probably null
R7940:Enpp2 UTSW 15 54906928 missense probably damaging 1.00
R7942:Enpp2 UTSW 15 54845879 missense probably damaging 1.00
R7951:Enpp2 UTSW 15 54919693 missense probably benign 0.00
R8069:Enpp2 UTSW 15 54847301 missense probably damaging 0.96
R8301:Enpp2 UTSW 15 54851407 missense probably benign
R8376:Enpp2 UTSW 15 54910095 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCTAGAGATAGCTTGACTGG -3'
(R):5'- ATGGGTGTACTTTAAAAGCCAGAG -3'

Sequencing Primer
(F):5'- CCCTTTGTGATGGCTTATC -3'
(R):5'- GTGTACTTTAAAAGCCAGAGTAGAC -3'
Posted On2019-05-15