Incidental Mutation 'R0614:Olfr1233'
ID54930
Institutional Source Beutler Lab
Gene Symbol Olfr1233
Ensembl Gene ENSMUSG00000075091
Gene Nameolfactory receptor 1233
SynonymsGA_x6K02T2Q125-50784973-50784056, MOR238-1
MMRRC Submission 038803-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0614 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89333208-89342398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89339985 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 106 (I106F)
Ref Sequence ENSEMBL: ENSMUSP00000149446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099784] [ENSMUST00000215469] [ENSMUST00000216561]
Predicted Effect probably damaging
Transcript: ENSMUST00000099784
AA Change: I106F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097372
Gene: ENSMUSG00000075091
AA Change: I106F

DomainStartEndE-ValueType
Pfam:7tm_4 25 299 1.1e-46 PFAM
Pfam:7tm_1 35 281 2.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215018
Predicted Effect probably damaging
Transcript: ENSMUST00000215469
AA Change: I106F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000216561
AA Change: I106F

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,192,663 T137I probably benign Het
3110082I17Rik C T 5: 139,364,031 V88I possibly damaging Het
4930453N24Rik T A 16: 64,766,614 Q249L probably damaging Het
Akap2 C A 4: 57,856,720 A926E probably benign Het
Ap1g2 C T 14: 55,099,773 V702I probably benign Het
Armcx5 G A X: 135,746,815 E547K probably damaging Het
Asah2 C A 19: 32,016,728 V406L probably damaging Het
Atp8b1 T C 18: 64,533,587 probably benign Het
Axl C A 7: 25,774,163 R346L probably benign Het
Baz1a G A 12: 54,941,519 R282* probably null Het
Card14 A G 11: 119,322,827 N200S probably benign Het
Cdt1 A G 8: 122,568,137 T28A probably benign Het
Cep250 C T 2: 155,970,097 Q438* probably null Het
Dapk1 C A 13: 60,718,132 P181Q probably damaging Het
Dnah17 C T 11: 118,070,568 probably benign Het
Dph7 T C 2: 24,968,956 probably null Het
Edc4 A T 8: 105,889,396 D801V possibly damaging Het
Eif4g2 A G 7: 111,077,223 probably null Het
Eml2 T C 7: 19,202,591 L531P probably damaging Het
Ephb2 T C 4: 136,673,365 Y533C probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fsip2 A G 2: 82,977,533 K1399E probably benign Het
Hcls1 A G 16: 36,962,625 D446G probably damaging Het
Hif1a T A 12: 73,945,631 N787K probably damaging Het
Ints14 T C 9: 64,964,433 S18P probably benign Het
Kalrn A T 16: 33,993,670 probably benign Het
Llgl2 T A 11: 115,850,267 D502E probably damaging Het
Lrwd1 A G 5: 136,123,500 V570A probably damaging Het
Mga C G 2: 119,964,466 P2877R probably damaging Het
Mvd T C 8: 122,436,553 I313V probably benign Het
Myo15b C A 11: 115,882,913 P270T probably damaging Het
Naip1 C A 13: 100,444,200 V180L probably benign Het
Ofd1 T C X: 166,435,540 probably benign Het
Olfr1423 A T 19: 12,036,565 M59K possibly damaging Het
Olfr348 T A 2: 36,786,693 L56H probably damaging Het
Otogl G A 10: 107,798,355 P1420S probably benign Het
Pcnt C T 10: 76,420,316 V697M probably damaging Het
Plekha7 A T 7: 116,154,645 Y702* probably null Het
Plxnb3 A G X: 73,764,358 probably benign Het
Ptgis A G 2: 167,206,882 F405L probably damaging Het
Ptprk C T 10: 28,075,136 P19L probably damaging Het
Ptprt A G 2: 161,812,120 V530A possibly damaging Het
Rasgrp4 A T 7: 29,145,851 Y299F probably damaging Het
Slc39a11 T A 11: 113,523,626 probably null Het
Slc6a15 T A 10: 103,404,352 L312* probably null Het
Slf1 T A 13: 77,049,114 M794L probably benign Het
Sntg2 G A 12: 30,257,978 T236I possibly damaging Het
Stau1 T C 2: 166,950,806 Y413C probably damaging Het
Syne2 T G 12: 75,912,353 probably null Het
Tas2r104 A T 6: 131,685,202 N181K probably damaging Het
Tmem81 G A 1: 132,507,731 V92I probably benign Het
Trap1 A G 16: 4,060,751 probably benign Het
Trip12 T C 1: 84,757,761 E905G probably damaging Het
Usp2 C T 9: 44,092,492 R494* probably null Het
Vps13a G T 19: 16,652,694 R2692S probably damaging Het
Zfhx3 T C 8: 108,948,539 S2074P probably benign Het
Zfhx3 C G 8: 108,948,967 Y2216* probably null Het
Zfp423 A G 8: 87,782,114 F409S probably damaging Het
Zfp472 G A 17: 32,977,934 E328K possibly damaging Het
Zfp619 T A 7: 39,537,675 M1043K possibly damaging Het
Zfp940 T C 7: 29,846,246 I79V probably benign Het
Other mutations in Olfr1233
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Olfr1233 APN 2 89340022 missense probably benign 0.01
IGL02130:Olfr1233 APN 2 89339583 missense probably damaging 1.00
IGL02264:Olfr1233 APN 2 89339684 missense probably benign 0.33
IGL03155:Olfr1233 APN 2 89339966 missense probably damaging 1.00
R0412:Olfr1233 UTSW 2 89340078 missense probably benign 0.03
R0558:Olfr1233 UTSW 2 89340236 missense probably benign 0.00
R1138:Olfr1233 UTSW 2 89340090 missense probably benign 0.03
R1969:Olfr1233 UTSW 2 89340296 missense probably damaging 1.00
R2192:Olfr1233 UTSW 2 89339665 nonsense probably null
R4417:Olfr1233 UTSW 2 89339987 missense probably benign 0.11
R5329:Olfr1233 UTSW 2 89339459 missense probably damaging 1.00
R5394:Olfr1233 UTSW 2 89339462 missense probably damaging 1.00
R5645:Olfr1233 UTSW 2 89339705 missense possibly damaging 0.94
R5949:Olfr1233 UTSW 2 89339885 missense probably damaging 1.00
R7524:Olfr1233 UTSW 2 89339877 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CCATGACATTGGGGCCACAGAAAG -3'
(R):5'- AACCTGCTCATTGTCGGGACCATAG -3'

Sequencing Primer
(F):5'- TTGGGGCCACAGAAAGGAATC -3'
(R):5'- TCGGGACCATAGTCTGTAGC -3'
Posted On2013-07-11