Incidental Mutation 'R7077:BC051142'
ID549301
Institutional Source Beutler Lab
Gene Symbol BC051142
Ensembl Gene ENSMUSG00000057246
Gene NamecDNA sequence BC051142
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R7077 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34398820-34460734 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34440882 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 93 (T93N)
Ref Sequence ENSEMBL: ENSMUSP00000109812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078615] [ENSMUST00000097348] [ENSMUST00000114175] [ENSMUST00000139063] [ENSMUST00000142317] [ENSMUST00000223957]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078615
AA Change: T95N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077685
Gene: ENSMUSG00000057246
AA Change: T95N

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 246 272 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 364 391 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097348
AA Change: T107N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000094961
Gene: ENSMUSG00000057246
AA Change: T107N

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 151 174 N/A INTRINSIC
low complexity region 253 279 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
low complexity region 371 398 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114175
AA Change: T93N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109812
Gene: ENSMUSG00000057246
AA Change: T93N

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 142 165 N/A INTRINSIC
SCOP:d1i7qa_ 227 277 5e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139063
AA Change: T130N

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121839
Gene: ENSMUSG00000057246
AA Change: T130N

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142317
SMART Domains Protein: ENSMUSP00000117413
Gene: ENSMUSG00000057246

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000223957
AA Change: T82N

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 C T 12: 81,559,119 C623Y probably damaging Het
Ago3 T C 4: 126,371,532 K322R probably null Het
Ankrd17 T C 5: 90,285,864 H682R possibly damaging Het
Aoah A G 13: 20,910,106 D187G probably damaging Het
Arhgap17 T C 7: 123,280,008 D840G unknown Het
AW551984 C T 9: 39,591,427 V650I probably benign Het
Bok T A 1: 93,689,189 Y86N probably damaging Het
Ccdc146 T A 5: 21,305,274 N580I possibly damaging Het
Ccng2 T C 5: 93,269,340 S72P possibly damaging Het
Cfap74 T G 4: 155,455,677 I977S unknown Het
Cobl T C 11: 12,253,441 N1087S probably benign Het
Cyp21a1 C A 17: 34,802,359 R346L probably damaging Het
Eif4a1 A C 11: 69,670,664 F52L probably damaging Het
Eif4ebp2 A C 10: 61,433,801 I120S probably damaging Het
Enpp2 A C 15: 54,901,391 D146E probably benign Het
Exosc9 T C 3: 36,553,056 Y30H probably damaging Het
Fam117a G A 11: 95,377,672 G300S probably benign Het
Focad C A 4: 88,410,677 A1709E unknown Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Fsip2 T C 2: 82,983,152 F3272L probably benign Het
Gcnt2 G A 13: 40,860,420 M22I probably benign Het
Gjd4 T C 18: 9,280,928 E50G probably damaging Het
Gm10375 G T 14: 43,602,970 T162K probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gm4924 T C 10: 82,379,223 F952L unknown Het
Heatr1 T C 13: 12,418,164 F1132L possibly damaging Het
Hnrnpu A G 1: 178,332,191 Y442H unknown Het
Hp1bp3 C A 4: 138,239,618 T408N probably damaging Het
Htra3 A G 5: 35,668,316 V198A probably damaging Het
Katnal1 T C 5: 148,891,737 T300A probably benign Het
Lipo5 G T 19: 33,467,770 P133Q Het
Lrp1b A T 2: 41,770,846 H197Q Het
Mdc1 C A 17: 35,845,947 A82D probably damaging Het
Mstn A T 1: 53,064,249 D248V probably benign Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Ola1 G A 2: 73,141,964 T221I probably damaging Het
Olfr1086 T C 2: 86,676,892 Y147C possibly damaging Het
Olfr67 A G 7: 103,787,386 I297T probably damaging Het
Olfr857 T A 9: 19,713,132 S102T probably benign Het
Olfr898 T A 9: 38,349,970 Y290N probably damaging Het
Phldb1 T C 9: 44,711,904 T618A possibly damaging Het
Pkd1 T G 17: 24,591,119 W3565G probably damaging Het
Prl3a1 A T 13: 27,276,103 N190I probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn11 C T 5: 121,143,570 R484Q probably benign Het
Rapgef4 T C 2: 72,241,476 M900T probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Smarcd3 G T 5: 24,594,962 A270D probably damaging Het
Srgap2 A G 1: 131,344,449 M33T Het
Tle1 G C 4: 72,158,375 P139A probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Zfp658 T A 7: 43,573,989 S563T probably benign Het
Zswim9 G A 7: 13,259,752 R826C probably damaging Het
Other mutations in BC051142
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:BC051142 APN 17 34420420 unclassified probably benign
IGL01516:BC051142 APN 17 34449260 missense possibly damaging 0.90
FR4304:BC051142 UTSW 17 34460055 unclassified probably benign
FR4304:BC051142 UTSW 17 34460077 unclassified probably benign
FR4340:BC051142 UTSW 17 34460060 nonsense probably null
FR4340:BC051142 UTSW 17 34460068 unclassified probably benign
FR4340:BC051142 UTSW 17 34460077 unclassified probably benign
FR4548:BC051142 UTSW 17 34460065 unclassified probably benign
FR4589:BC051142 UTSW 17 34460053 unclassified probably benign
FR4589:BC051142 UTSW 17 34460073 unclassified probably benign
FR4737:BC051142 UTSW 17 34460051 unclassified probably benign
FR4737:BC051142 UTSW 17 34460068 unclassified probably benign
FR4976:BC051142 UTSW 17 34460058 unclassified probably benign
FR4976:BC051142 UTSW 17 34460061 unclassified probably benign
R0046:BC051142 UTSW 17 34460121 critical splice donor site probably null
R0046:BC051142 UTSW 17 34460121 critical splice donor site probably null
R0523:BC051142 UTSW 17 34445499 critical splice donor site probably null
R0661:BC051142 UTSW 17 34459913 missense possibly damaging 0.90
R2224:BC051142 UTSW 17 34448763 splice site probably null
R2937:BC051142 UTSW 17 34421862 missense possibly damaging 0.92
R3932:BC051142 UTSW 17 34443443 missense possibly damaging 0.94
R4210:BC051142 UTSW 17 34460283 unclassified probably benign
R4924:BC051142 UTSW 17 34459977 missense probably damaging 0.96
R5055:BC051142 UTSW 17 34448796 missense possibly damaging 0.83
R5446:BC051142 UTSW 17 34440893 splice site probably null
R6147:BC051142 UTSW 17 34418923 missense possibly damaging 0.95
R6851:BC051142 UTSW 17 34460172 missense possibly damaging 0.66
R6866:BC051142 UTSW 17 34459961 missense possibly damaging 0.66
R7035:BC051142 UTSW 17 34460331 unclassified probably benign
R7556:BC051142 UTSW 17 34437717 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGGCAAAGGTCTTTTCCCTG -3'
(R):5'- GCTGGATAAGGACTAGTGGGTC -3'

Sequencing Primer
(F):5'- AAAGGTCTTTTCCCTGCCTGAG -3'
(R):5'- GGGTTCCACTGCCATAGTTAATATC -3'
Posted On2019-05-15