Incidental Mutation 'R7077:Cyp21a1'
ID549302
Institutional Source Beutler Lab
Gene Symbol Cyp21a1
Ensembl Gene ENSMUSG00000024365
Gene Namecytochrome P450, family 21, subfamily a, polypeptide 1
SynonymsOh21-1, 21OHA, 21-hydroxylase, 21-OH, Cyp21, 21OH, Oh21-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.609) question?
Stock #R7077 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location34801348-34804561 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34802359 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 346 (R346L)
Ref Sequence ENSEMBL: ENSMUSP00000025223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025223]
Predicted Effect probably damaging
Transcript: ENSMUST00000025223
AA Change: R346L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025223
Gene: ENSMUSG00000024365
AA Change: R346L

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:p450 29 473 3.9e-98 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and hydroxylates steroids at the 21 position. Its activity is required for the synthesis of steroid hormones including cortisol and aldosterone. Mutations in this gene cause congenital adrenal hyperplasia. A related pseudogene is located near this gene; gene conversion events involving the functional gene and the pseudogene are thought to account for many cases of steroid 21-hydroxylase deficiency. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: An 80kb deletion including Cyp21a1 is found in mice with the H2 haplotype aw18. Homozygotes are lethal, but can be rescued with a Cyp21a1 transgene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 C T 12: 81,559,119 C623Y probably damaging Het
Ago3 T C 4: 126,371,532 K322R probably null Het
Ankrd17 T C 5: 90,285,864 H682R possibly damaging Het
Aoah A G 13: 20,910,106 D187G probably damaging Het
Arhgap17 T C 7: 123,280,008 D840G unknown Het
AW551984 C T 9: 39,591,427 V650I probably benign Het
BC051142 C A 17: 34,440,882 T93N possibly damaging Het
Bok T A 1: 93,689,189 Y86N probably damaging Het
Ccdc146 T A 5: 21,305,274 N580I possibly damaging Het
Ccng2 T C 5: 93,269,340 S72P possibly damaging Het
Cfap74 T G 4: 155,455,677 I977S unknown Het
Cobl T C 11: 12,253,441 N1087S probably benign Het
Eif4a1 A C 11: 69,670,664 F52L probably damaging Het
Eif4ebp2 A C 10: 61,433,801 I120S probably damaging Het
Enpp2 A C 15: 54,901,391 D146E probably benign Het
Exosc9 T C 3: 36,553,056 Y30H probably damaging Het
Fam117a G A 11: 95,377,672 G300S probably benign Het
Focad C A 4: 88,410,677 A1709E unknown Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Fsip2 T C 2: 82,983,152 F3272L probably benign Het
Gcnt2 G A 13: 40,860,420 M22I probably benign Het
Gjd4 T C 18: 9,280,928 E50G probably damaging Het
Gm10375 G T 14: 43,602,970 T162K probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gm4924 T C 10: 82,379,223 F952L unknown Het
Heatr1 T C 13: 12,418,164 F1132L possibly damaging Het
Hnrnpu A G 1: 178,332,191 Y442H unknown Het
Hp1bp3 C A 4: 138,239,618 T408N probably damaging Het
Htra3 A G 5: 35,668,316 V198A probably damaging Het
Katnal1 T C 5: 148,891,737 T300A probably benign Het
Lipo5 G T 19: 33,467,770 P133Q Het
Lrp1b A T 2: 41,770,846 H197Q Het
Mdc1 C A 17: 35,845,947 A82D probably damaging Het
Mstn A T 1: 53,064,249 D248V probably benign Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Ola1 G A 2: 73,141,964 T221I probably damaging Het
Olfr1086 T C 2: 86,676,892 Y147C possibly damaging Het
Olfr67 A G 7: 103,787,386 I297T probably damaging Het
Olfr857 T A 9: 19,713,132 S102T probably benign Het
Olfr898 T A 9: 38,349,970 Y290N probably damaging Het
Phldb1 T C 9: 44,711,904 T618A possibly damaging Het
Pkd1 T G 17: 24,591,119 W3565G probably damaging Het
Prl3a1 A T 13: 27,276,103 N190I probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn11 C T 5: 121,143,570 R484Q probably benign Het
Rapgef4 T C 2: 72,241,476 M900T probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Smarcd3 G T 5: 24,594,962 A270D probably damaging Het
Srgap2 A G 1: 131,344,449 M33T Het
Tle1 G C 4: 72,158,375 P139A probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Zfp658 T A 7: 43,573,989 S563T probably benign Het
Zswim9 G A 7: 13,259,752 R826C probably damaging Het
Other mutations in Cyp21a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Cyp21a1 APN 17 34804134 critical splice acceptor site probably null
IGL01688:Cyp21a1 APN 17 34802220 missense probably damaging 1.00
IGL02352:Cyp21a1 APN 17 34804222 missense probably damaging 1.00
IGL02359:Cyp21a1 APN 17 34804222 missense probably damaging 1.00
IGL02418:Cyp21a1 APN 17 34804188 splice site probably benign
IGL03089:Cyp21a1 APN 17 34803446 splice site probably null
R0480:Cyp21a1 UTSW 17 34801826 missense probably damaging 1.00
R1386:Cyp21a1 UTSW 17 34802210 missense probably damaging 0.98
R1831:Cyp21a1 UTSW 17 34804035 splice site probably benign
R2159:Cyp21a1 UTSW 17 34802404 missense probably benign 0.21
R2209:Cyp21a1 UTSW 17 34802727 nonsense probably null
R4968:Cyp21a1 UTSW 17 34803409 missense possibly damaging 0.93
R5957:Cyp21a1 UTSW 17 34803176 missense probably benign 0.13
R6374:Cyp21a1 UTSW 17 34804136 splice site probably null
R7143:Cyp21a1 UTSW 17 34802326 missense probably damaging 1.00
R7798:Cyp21a1 UTSW 17 34804321 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- ACCATCTCATCCAGGTTGGC -3'
(R):5'- TAGGGTCAGCTAGATGGCAG -3'

Sequencing Primer
(F):5'- ATCCAGGTTGGCGCCTTG -3'
(R):5'- TGGGCAGCTGTGAGCCAC -3'
Posted On2019-05-15