Incidental Mutation 'R7077:Fsd1'
ID549304
Institutional Source Beutler Lab
Gene Symbol Fsd1
Ensembl Gene ENSMUSG00000011589
Gene Namefibronectin type 3 and SPRY domain-containing protein
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_183178.2; Ensembl: ENSMUST00000011733

Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R7077 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location55986511-55996881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55993876 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 245 (R245H)
Ref Sequence ENSEMBL: ENSMUSP00000011733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011733] [ENSMUST00000043785]
Predicted Effect probably damaging
Transcript: ENSMUST00000011733
AA Change: R245H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000011733
Gene: ENSMUSG00000011589
AA Change: R245H

DomainStartEndE-ValueType
BBC 4 130 7.61e-9 SMART
FN3 165 255 2.96e-4 SMART
Pfam:SPRY 355 473 6.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043785
SMART Domains Protein: ENSMUSP00000038130
Gene: ENSMUSG00000038781

DomainStartEndE-ValueType
PH 20 120 1.22e-3 SMART
SH2 150 239 2.58e-3 SMART
low complexity region 278 297 N/A INTRINSIC
low complexity region 302 312 N/A INTRINSIC
low complexity region 343 365 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosome associated protein that is characterized by an N-terminal coiled-coil region downstream of B-box (BBC) domain, a central fibronectin type III domain, and a C-terminal repeats in splA and RyR (SPRY) domain. The encoded protein associates with a subset of microtubules and may be involved in the stability and organization of microtubules during cytokinesis. [provided by RefSeq, Apr 2009]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 C T 12: 81,559,119 C623Y probably damaging Het
Ago3 T C 4: 126,371,532 K322R probably null Het
Ankrd17 T C 5: 90,285,864 H682R possibly damaging Het
Aoah A G 13: 20,910,106 D187G probably damaging Het
Arhgap17 T C 7: 123,280,008 D840G unknown Het
AW551984 C T 9: 39,591,427 V650I probably benign Het
BC051142 C A 17: 34,440,882 T93N possibly damaging Het
Bok T A 1: 93,689,189 Y86N probably damaging Het
Ccdc146 T A 5: 21,305,274 N580I possibly damaging Het
Ccng2 T C 5: 93,269,340 S72P possibly damaging Het
Cfap74 T G 4: 155,455,677 I977S unknown Het
Cobl T C 11: 12,253,441 N1087S probably benign Het
Cyp21a1 C A 17: 34,802,359 R346L probably damaging Het
Eif4a1 A C 11: 69,670,664 F52L probably damaging Het
Eif4ebp2 A C 10: 61,433,801 I120S probably damaging Het
Enpp2 A C 15: 54,901,391 D146E probably benign Het
Exosc9 T C 3: 36,553,056 Y30H probably damaging Het
Fam117a G A 11: 95,377,672 G300S probably benign Het
Focad C A 4: 88,410,677 A1709E unknown Het
Fsip2 T C 2: 82,983,152 F3272L probably benign Het
Gcnt2 G A 13: 40,860,420 M22I probably benign Het
Gjd4 T C 18: 9,280,928 E50G probably damaging Het
Gm10375 G T 14: 43,602,970 T162K probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gm4924 T C 10: 82,379,223 F952L unknown Het
Heatr1 T C 13: 12,418,164 F1132L possibly damaging Het
Hnrnpu A G 1: 178,332,191 Y442H unknown Het
Hp1bp3 C A 4: 138,239,618 T408N probably damaging Het
Htra3 A G 5: 35,668,316 V198A probably damaging Het
Katnal1 T C 5: 148,891,737 T300A probably benign Het
Lipo5 G T 19: 33,467,770 P133Q Het
Lrp1b A T 2: 41,770,846 H197Q Het
Mdc1 C A 17: 35,845,947 A82D probably damaging Het
Mstn A T 1: 53,064,249 D248V probably benign Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Ola1 G A 2: 73,141,964 T221I probably damaging Het
Olfr1086 T C 2: 86,676,892 Y147C possibly damaging Het
Olfr67 A G 7: 103,787,386 I297T probably damaging Het
Olfr857 T A 9: 19,713,132 S102T probably benign Het
Olfr898 T A 9: 38,349,970 Y290N probably damaging Het
Phldb1 T C 9: 44,711,904 T618A possibly damaging Het
Pkd1 T G 17: 24,591,119 W3565G probably damaging Het
Prl3a1 A T 13: 27,276,103 N190I probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptpn11 C T 5: 121,143,570 R484Q probably benign Het
Rapgef4 T C 2: 72,241,476 M900T probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Smarcd3 G T 5: 24,594,962 A270D probably damaging Het
Srgap2 A G 1: 131,344,449 M33T Het
Tle1 G C 4: 72,158,375 P139A probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Zfp658 T A 7: 43,573,989 S563T probably benign Het
Zswim9 G A 7: 13,259,752 R826C probably damaging Het
Other mutations in Fsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Fsd1 APN 17 55993943 critical splice donor site probably null
IGL01023:Fsd1 APN 17 55988245 missense probably damaging 1.00
IGL01382:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01383:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01384:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01386:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01387:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01561:Fsd1 APN 17 55995363 missense probably benign
IGL02065:Fsd1 APN 17 55996499 missense probably damaging 1.00
IGL02172:Fsd1 APN 17 55990244 splice site probably benign
IGL02515:Fsd1 APN 17 55996303 missense probably null 1.00
IGL02674:Fsd1 APN 17 55996483 missense probably benign 0.04
IGL03135:Fsd1 APN 17 55990416 splice site probably null
IGL03380:Fsd1 APN 17 55995456 missense probably benign 0.00
emboldened UTSW 17 55990542 critical splice donor site probably null
1mM(1):Fsd1 UTSW 17 55988199 missense probably benign 0.26
R0201:Fsd1 UTSW 17 55990522 missense probably benign 0.00
R0521:Fsd1 UTSW 17 55991245 missense probably benign
R0718:Fsd1 UTSW 17 55996445 unclassified probably null
R1077:Fsd1 UTSW 17 55990542 critical splice donor site probably null
R1519:Fsd1 UTSW 17 55993870 missense probably benign 0.14
R1696:Fsd1 UTSW 17 55988257 critical splice donor site probably null
R1867:Fsd1 UTSW 17 55991254 missense probably benign 0.00
R2173:Fsd1 UTSW 17 55991223 missense possibly damaging 0.64
R3889:Fsd1 UTSW 17 55993893 missense probably benign 0.27
R3950:Fsd1 UTSW 17 55995517 critical splice donor site probably null
R4787:Fsd1 UTSW 17 55996257 missense possibly damaging 0.51
R4912:Fsd1 UTSW 17 55991241 missense possibly damaging 0.71
R4936:Fsd1 UTSW 17 55996452 missense possibly damaging 0.63
R5718:Fsd1 UTSW 17 55990542 critical splice donor site probably benign
R5749:Fsd1 UTSW 17 55995849 splice site probably null
R7078:Fsd1 UTSW 17 55993876 missense probably damaging 1.00
R7091:Fsd1 UTSW 17 55993876 missense probably damaging 1.00
R7092:Fsd1 UTSW 17 55993876 missense probably damaging 1.00
R7137:Fsd1 UTSW 17 55993876 missense probably damaging 1.00
R7173:Fsd1 UTSW 17 55996696 missense possibly damaging 0.47
R7174:Fsd1 UTSW 17 55991356 missense probably benign 0.01
R7474:Fsd1 UTSW 17 55988149 missense possibly damaging 0.93
R7727:Fsd1 UTSW 17 55988150 missense probably benign 0.00
X0022:Fsd1 UTSW 17 55995464 nonsense probably null
Z1088:Fsd1 UTSW 17 55991203 missense probably damaging 0.98
Z1177:Fsd1 UTSW 17 55996083 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGAAGGCGAGACTTGGTGTC -3'
(R):5'- AGTTCCCTAGCAGCTAGAGTG -3'

Sequencing Primer
(F):5'- ACCTGCTGCTCTTACAGAGGAC -3'
(R):5'- CTAGCAGCTAGAGTGACCAGGTC -3'
Posted On2019-05-15