Incidental Mutation 'R0614:Mga'
ID 54931
Institutional Source Beutler Lab
Gene Symbol Mga
Ensembl Gene ENSMUSG00000033943
Gene Name MAX gene associated
Synonyms D030062C11Rik, Mga, Mad5, C130042M01Rik
MMRRC Submission 038803-MU
Accession Numbers

Ncbi RefSeq: NM_013720.2, NM_001164274.1; MGI: 1352483

Essential gene? Probably essential (E-score: 0.943) question?
Stock # R0614 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 119897228-119969581 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 119964466 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Arginine at position 2877 (P2877R)
Ref Sequence ENSEMBL: ENSMUSP00000106401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046717] [ENSMUST00000079934] [ENSMUST00000110773] [ENSMUST00000110774] [ENSMUST00000156510]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000046717
AA Change: P2838R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043795
Gene: ENSMUSG00000033943
AA Change: P2838R

DomainStartEndE-ValueType
Blast:TBOX 6 73 6e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1796 1818 N/A INTRINSIC
low complexity region 1833 1850 N/A INTRINSIC
low complexity region 1977 1992 N/A INTRINSIC
low complexity region 2183 2197 N/A INTRINSIC
low complexity region 2241 2259 N/A INTRINSIC
HLH 2368 2419 8.27e-7 SMART
low complexity region 2748 2769 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079934
AA Change: P2668R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000078853
Gene: ENSMUSG00000033943
AA Change: P2668R

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
low complexity region 2578 2599 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110773
AA Change: P2759R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106400
Gene: ENSMUSG00000033943
AA Change: P2759R

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 890 899 N/A INTRINSIC
low complexity region 938 952 N/A INTRINSIC
low complexity region 1033 1059 N/A INTRINSIC
low complexity region 1169 1190 N/A INTRINSIC
low complexity region 1222 1236 N/A INTRINSIC
low complexity region 1485 1502 N/A INTRINSIC
low complexity region 1555 1570 N/A INTRINSIC
low complexity region 1602 1637 N/A INTRINSIC
low complexity region 1717 1739 N/A INTRINSIC
low complexity region 1754 1771 N/A INTRINSIC
low complexity region 1898 1913 N/A INTRINSIC
low complexity region 2104 2118 N/A INTRINSIC
low complexity region 2162 2180 N/A INTRINSIC
HLH 2289 2340 8.27e-7 SMART
low complexity region 2669 2690 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110774
AA Change: P2877R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106401
Gene: ENSMUSG00000033943
AA Change: P2877R

DomainStartEndE-ValueType
Blast:TBOX 6 73 7e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
Pfam:DUF4801 1037 1085 1e-19 PFAM
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1835 1857 N/A INTRINSIC
low complexity region 1872 1889 N/A INTRINSIC
low complexity region 2016 2031 N/A INTRINSIC
low complexity region 2222 2236 N/A INTRINSIC
low complexity region 2280 2298 N/A INTRINSIC
HLH 2407 2458 8.27e-7 SMART
low complexity region 2787 2808 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131396
Predicted Effect probably benign
Transcript: ENSMUST00000156510
SMART Domains Protein: ENSMUSP00000119044
Gene: ENSMUSG00000033943

DomainStartEndE-ValueType
Blast:TBOX 6 73 4e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
Meta Mutation Damage Score 0.1235 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (61/63)
MGI Phenotype PHENOTYPE: Embryos homozygous for a gene trap allele die shortly after implantation due to defective development of the inner cell mass (ICM) and the epiblast. ICM derivatives fail to develop past E4.5 and show increased apoptosis but no change in cell proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(135) : Gene trapped(135)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C T 13: 77,192,663 T137I probably benign Het
3110082I17Rik C T 5: 139,364,031 V88I possibly damaging Het
4930453N24Rik T A 16: 64,766,614 Q249L probably damaging Het
Akap2 C A 4: 57,856,720 A926E probably benign Het
Ap1g2 C T 14: 55,099,773 V702I probably benign Het
Armcx5 G A X: 135,746,815 E547K probably damaging Het
Asah2 C A 19: 32,016,728 V406L probably damaging Het
Atp8b1 T C 18: 64,533,587 probably benign Het
Axl C A 7: 25,774,163 R346L probably benign Het
Baz1a G A 12: 54,941,519 R282* probably null Het
Card14 A G 11: 119,322,827 N200S probably benign Het
Cdt1 A G 8: 122,568,137 T28A probably benign Het
Cep250 C T 2: 155,970,097 Q438* probably null Het
Dapk1 C A 13: 60,718,132 P181Q probably damaging Het
Dnah17 C T 11: 118,070,568 probably benign Het
Dph7 T C 2: 24,968,956 probably null Het
Edc4 A T 8: 105,889,396 D801V possibly damaging Het
Eif4g2 A G 7: 111,077,223 probably null Het
Eml2 T C 7: 19,202,591 L531P probably damaging Het
Ephb2 T C 4: 136,673,365 Y533C probably benign Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Fsip2 A G 2: 82,977,533 K1399E probably benign Het
Hcls1 A G 16: 36,962,625 D446G probably damaging Het
Hif1a T A 12: 73,945,631 N787K probably damaging Het
Ints14 T C 9: 64,964,433 S18P probably benign Het
Kalrn A T 16: 33,993,670 probably benign Het
Llgl2 T A 11: 115,850,267 D502E probably damaging Het
Lrwd1 A G 5: 136,123,500 V570A probably damaging Het
Mvd T C 8: 122,436,553 I313V probably benign Het
Myo15b C A 11: 115,882,913 P270T probably damaging Het
Naip1 C A 13: 100,444,200 V180L probably benign Het
Ofd1 T C X: 166,435,540 probably benign Het
Olfr1233 T A 2: 89,339,985 I106F probably damaging Het
Olfr1423 A T 19: 12,036,565 M59K possibly damaging Het
Olfr348 T A 2: 36,786,693 L56H probably damaging Het
Otogl G A 10: 107,798,355 P1420S probably benign Het
Pcnt C T 10: 76,420,316 V697M probably damaging Het
Plekha7 A T 7: 116,154,645 Y702* probably null Het
Plxnb3 A G X: 73,764,358 probably benign Het
Ptgis A G 2: 167,206,882 F405L probably damaging Het
Ptprk C T 10: 28,075,136 P19L probably damaging Het
Ptprt A G 2: 161,812,120 V530A possibly damaging Het
Rasgrp4 A T 7: 29,145,851 Y299F probably damaging Het
Slc39a11 T A 11: 113,523,626 probably null Het
Slc6a15 T A 10: 103,404,352 L312* probably null Het
Slf1 T A 13: 77,049,114 M794L probably benign Het
Sntg2 G A 12: 30,257,978 T236I possibly damaging Het
Stau1 T C 2: 166,950,806 Y413C probably damaging Het
Syne2 T G 12: 75,912,353 probably null Het
Tas2r104 A T 6: 131,685,202 N181K probably damaging Het
Tmem81 G A 1: 132,507,731 V92I probably benign Het
Trap1 A G 16: 4,060,751 probably benign Het
Trip12 T C 1: 84,757,761 E905G probably damaging Het
Usp2 C T 9: 44,092,492 R494* probably null Het
Vps13a G T 19: 16,652,694 R2692S probably damaging Het
Zfhx3 T C 8: 108,948,539 S2074P probably benign Het
Zfhx3 C G 8: 108,948,967 Y2216* probably null Het
Zfp423 A G 8: 87,782,114 F409S probably damaging Het
Zfp472 G A 17: 32,977,934 E328K possibly damaging Het
Zfp619 T A 7: 39,537,675 M1043K possibly damaging Het
Zfp940 T C 7: 29,846,246 I79V probably benign Het
Other mutations in Mga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Mga APN 2 119919814 missense possibly damaging 0.65
IGL00719:Mga APN 2 119947453 nonsense probably null
IGL01619:Mga APN 2 119931828 missense possibly damaging 0.46
IGL01721:Mga APN 2 119935239 missense probably damaging 1.00
IGL01759:Mga APN 2 119951195 missense possibly damaging 0.92
IGL01785:Mga APN 2 119902912 missense probably damaging 1.00
IGL01786:Mga APN 2 119902912 missense probably damaging 1.00
IGL01950:Mga APN 2 119941654 missense possibly damaging 0.60
IGL01960:Mga APN 2 119938657 missense probably damaging 1.00
IGL02086:Mga APN 2 119924036 missense probably damaging 0.99
IGL02364:Mga APN 2 119964054 missense possibly damaging 0.66
IGL02602:Mga APN 2 119931884 missense possibly damaging 0.66
IGL02751:Mga APN 2 119947770 missense possibly damaging 0.82
IGL02794:Mga APN 2 119946289 missense possibly damaging 0.84
IGL03247:Mga APN 2 119935513 missense possibly damaging 0.81
IGL03303:Mga APN 2 119903452 missense probably damaging 1.00
PIT4515001:Mga UTSW 2 119916504 missense probably damaging 1.00
R0060:Mga UTSW 2 119960961 critical splice donor site probably null
R0060:Mga UTSW 2 119960961 critical splice donor site probably null
R0417:Mga UTSW 2 119902790 missense probably damaging 0.99
R0449:Mga UTSW 2 119941381 missense probably damaging 1.00
R0457:Mga UTSW 2 119916488 missense probably damaging 0.98
R0538:Mga UTSW 2 119919706 critical splice donor site probably null
R0568:Mga UTSW 2 119935422 missense probably damaging 1.00
R0671:Mga UTSW 2 119919910 splice site probably null
R0811:Mga UTSW 2 119947961 missense probably damaging 0.99
R0812:Mga UTSW 2 119947961 missense probably damaging 0.99
R0948:Mga UTSW 2 119941659 missense possibly damaging 0.77
R1177:Mga UTSW 2 119926446 missense probably damaging 1.00
R1445:Mga UTSW 2 119902698 missense probably damaging 1.00
R1476:Mga UTSW 2 119941675 missense probably damaging 0.96
R1527:Mga UTSW 2 119916597 missense probably damaging 1.00
R1583:Mga UTSW 2 119963960 missense possibly damaging 0.66
R1592:Mga UTSW 2 119964666 missense possibly damaging 0.93
R1627:Mga UTSW 2 119964562 missense probably damaging 1.00
R1658:Mga UTSW 2 119941689 missense possibly damaging 0.63
R1677:Mga UTSW 2 119960852 missense possibly damaging 0.92
R1887:Mga UTSW 2 119923617 missense probably damaging 1.00
R1908:Mga UTSW 2 119926594 missense possibly damaging 0.66
R1909:Mga UTSW 2 119926594 missense possibly damaging 0.66
R2061:Mga UTSW 2 119964980 unclassified probably benign
R2145:Mga UTSW 2 119964157 missense possibly damaging 0.85
R2159:Mga UTSW 2 119919643 missense probably damaging 0.96
R2179:Mga UTSW 2 119960442 missense probably damaging 0.99
R2281:Mga UTSW 2 119903723 missense probably benign
R2423:Mga UTSW 2 119964793 missense probably damaging 1.00
R3620:Mga UTSW 2 119916668 missense probably damaging 1.00
R3622:Mga UTSW 2 119941764 missense probably damaging 1.00
R3624:Mga UTSW 2 119941764 missense probably damaging 1.00
R3802:Mga UTSW 2 119947339 missense probably damaging 0.96
R4011:Mga UTSW 2 119931780 missense probably damaging 1.00
R4065:Mga UTSW 2 119947002 missense probably damaging 1.00
R4520:Mga UTSW 2 119948098 missense possibly damaging 0.85
R4649:Mga UTSW 2 119941493 missense possibly damaging 0.81
R4660:Mga UTSW 2 119938623 intron probably benign
R4757:Mga UTSW 2 119903639 missense possibly damaging 0.82
R4771:Mga UTSW 2 119964294 missense probably damaging 1.00
R4784:Mga UTSW 2 119903057 missense probably damaging 1.00
R4866:Mga UTSW 2 119964054 missense possibly damaging 0.66
R4900:Mga UTSW 2 119964054 missense possibly damaging 0.66
R4952:Mga UTSW 2 119903301 missense probably damaging 1.00
R4995:Mga UTSW 2 119932582 nonsense probably null
R5020:Mga UTSW 2 119951173 nonsense probably null
R5082:Mga UTSW 2 119903344 missense probably damaging 0.98
R5208:Mga UTSW 2 119947981 missense possibly damaging 0.83
R5454:Mga UTSW 2 119903329 missense probably damaging 0.99
R5466:Mga UTSW 2 119902697 missense probably damaging 1.00
R5484:Mga UTSW 2 119916626 missense possibly damaging 0.58
R5669:Mga UTSW 2 119903426 missense probably damaging 1.00
R5819:Mga UTSW 2 119941263 missense possibly damaging 0.61
R5916:Mga UTSW 2 119964312 missense probably benign 0.27
R5942:Mga UTSW 2 119946959 missense probably benign 0.41
R6305:Mga UTSW 2 119947698 missense probably benign 0.00
R6434:Mga UTSW 2 119923938 missense probably damaging 0.99
R6467:Mga UTSW 2 119946295 missense probably damaging 1.00
R6488:Mga UTSW 2 119960907 missense probably damaging 1.00
R6630:Mga UTSW 2 119923659 missense probably damaging 0.99
R6790:Mga UTSW 2 119923754 missense probably damaging 0.99
R7029:Mga UTSW 2 119923550 missense probably damaging 1.00
R7039:Mga UTSW 2 119932678 missense probably benign 0.28
R7088:Mga UTSW 2 119961936 missense probably damaging 1.00
R7195:Mga UTSW 2 119917328 missense probably damaging 1.00
R7273:Mga UTSW 2 119935214 missense probably damaging 1.00
R7286:Mga UTSW 2 119964788 missense possibly damaging 0.93
R7346:Mga UTSW 2 119935527 missense possibly damaging 0.56
R7383:Mga UTSW 2 119960340 missense probably damaging 0.99
R7469:Mga UTSW 2 119903046 missense probably damaging 1.00
R7484:Mga UTSW 2 119946229 missense probably damaging 0.99
R7537:Mga UTSW 2 119935551 missense probably damaging 0.97
R7781:Mga UTSW 2 119917357 missense probably damaging 1.00
R7921:Mga UTSW 2 119919678 missense probably damaging 1.00
R8165:Mga UTSW 2 119947238 missense probably benign 0.12
R8226:Mga UTSW 2 119960385 missense probably benign 0.33
R8305:Mga UTSW 2 119946319 missense possibly damaging 0.77
R8309:Mga UTSW 2 119960930 missense probably damaging 1.00
R8363:Mga UTSW 2 119963926 missense probably benign 0.43
R8388:Mga UTSW 2 119964081 missense probably benign 0.00
R8524:Mga UTSW 2 119941516 missense probably damaging 0.97
R8693:Mga UTSW 2 119963926 missense possibly damaging 0.65
R8837:Mga UTSW 2 119938791 splice site probably benign
R8916:Mga UTSW 2 119958338 missense possibly damaging 0.92
R8936:Mga UTSW 2 119964228 missense probably damaging 1.00
R9028:Mga UTSW 2 119947589 missense probably benign
R9145:Mga UTSW 2 119964012 missense probably benign
R9155:Mga UTSW 2 119926532 missense probably damaging 1.00
R9308:Mga UTSW 2 119923888 missense possibly damaging 0.91
R9342:Mga UTSW 2 119948175 missense probably benign
R9347:Mga UTSW 2 119903037 missense probably damaging 1.00
R9390:Mga UTSW 2 119963851 missense probably damaging 0.99
R9408:Mga UTSW 2 119935518 missense possibly damaging 0.92
R9488:Mga UTSW 2 119964823 missense possibly damaging 0.90
R9495:Mga UTSW 2 119951195 missense possibly damaging 0.92
R9521:Mga UTSW 2 119964498 missense probably damaging 0.99
R9780:Mga UTSW 2 119916772 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TGATGACTCTGGCCTAGCTGAACTG -3'
(R):5'- TGAGACTCTGACCATCGGCATCAC -3'

Sequencing Primer
(F):5'- CCTAGCTGAACTGTCAGGTTCTATG -3'
(R):5'- ACCTAATGGGGCCAACTTTG -3'
Posted On 2013-07-11