Mutagenetix > Incidental Mutation

Incidental Mutation 'R0614:Cep250'

54932

Institutional Source

Beutler Lab

Gene Symbol

Cep250

Ensembl Gene

ENSMUSG00000038241

Gene Name

centrosomal protein 250

Synonyms

Cep2, Inmp, B230210E21Rik

MMRRC Submission

038803-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0614 (G1)

Quality Score

175

Status

Validated

Chromosome

Chromosomal Location

155956458-155998900 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 155970097 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 438 (Q438*)

Ref Sequence

ENSEMBL: ENSMUSP00000114426 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039994] [ENSMUST00000094421] [ENSMUST00000109618] [ENSMUST00000109619] [ENSMUST00000124812] [ENSMUST00000151569]

AlphaFold

Q60952

Predicted Effect

probably null
Transcript: ENSMUST00000039994
AA Change: Q438*

SMART Domains

Protein: ENSMUSP00000038255
Gene: ENSMUSG00000038241
AA Change: Q438*

Domain	Start	End	E-Value	Type
Pfam:Rootletin	38	215	4.2e-56	PFAM
low complexity region	228	241	N/A	INTRINSIC
coiled coil region	248	327	N/A	INTRINSIC
internal_repeat_1	444	460	1.47e-18	PROSPERO
internal_repeat_1	465	481	1.47e-18	PROSPERO
low complexity region	495	506	N/A	INTRINSIC
low complexity region	557	580	N/A	INTRINSIC
low complexity region	583	595	N/A	INTRINSIC
low complexity region	635	650	N/A	INTRINSIC
low complexity region	669	677	N/A	INTRINSIC
low complexity region	688	703	N/A	INTRINSIC
low complexity region	708	719	N/A	INTRINSIC
low complexity region	896	914	N/A	INTRINSIC
low complexity region	990	1007	N/A	INTRINSIC
low complexity region	1043	1053	N/A	INTRINSIC
low complexity region	1138	1143	N/A	INTRINSIC
low complexity region	1182	1195	N/A	INTRINSIC
coiled coil region	1257	1687	N/A	INTRINSIC
low complexity region	1872	1895	N/A	INTRINSIC
low complexity region	1919	1933	N/A	INTRINSIC
low complexity region	1941	1960	N/A	INTRINSIC
internal_repeat_2	2002	2052	3.9e-6	PROSPERO
coiled coil region	2068	2169	N/A	INTRINSIC
coiled coil region	2196	2217	N/A	INTRINSIC
coiled coil region	2251	2310	N/A	INTRINSIC
low complexity region	2325	2338	N/A	INTRINSIC
coiled coil region	2340	2366	N/A	INTRINSIC
low complexity region	2379	2388	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000094421
AA Change: Q439*

SMART Domains

Protein: ENSMUSP00000091988
Gene: ENSMUSG00000038241
AA Change: Q439*

Domain	Start	End	E-Value	Type
Pfam:Rootletin	38	215	5.4e-56	PFAM
low complexity region	228	241	N/A	INTRINSIC
coiled coil region	248	357	N/A	INTRINSIC
coiled coil region	400	1165	N/A	INTRINSIC
coiled coil region	1237	1667	N/A	INTRINSIC
low complexity region	1852	1875	N/A	INTRINSIC
low complexity region	1899	1913	N/A	INTRINSIC
low complexity region	1921	1940	N/A	INTRINSIC
internal_repeat_1	1982	2032	3.35e-6	PROSPERO
coiled coil region	2048	2149	N/A	INTRINSIC
coiled coil region	2176	2197	N/A	INTRINSIC
coiled coil region	2231	2290	N/A	INTRINSIC
low complexity region	2305	2318	N/A	INTRINSIC
coiled coil region	2320	2346	N/A	INTRINSIC
low complexity region	2359	2368	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109618

SMART Domains

Protein: ENSMUSP00000105247
Gene: ENSMUSG00000038241

Domain	Start	End	E-Value	Type
Pfam:Rootletin	38	215	2.3e-57	PFAM
low complexity region	228	241	N/A	INTRINSIC
coiled coil region	248	317	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000109619
AA Change: Q439*

SMART Domains

Protein: ENSMUSP00000105248
Gene: ENSMUSG00000038241
AA Change: Q439*

Domain	Start	End	E-Value	Type
Pfam:Rootletin	38	214	4.1e-60	PFAM
low complexity region	215	225	N/A	INTRINSIC
low complexity region	228	241	N/A	INTRINSIC
coiled coil region	248	357	N/A	INTRINSIC
internal_repeat_1	445	461	1.51e-18	PROSPERO
internal_repeat_1	466	482	1.51e-18	PROSPERO
low complexity region	496	507	N/A	INTRINSIC
low complexity region	558	581	N/A	INTRINSIC
low complexity region	584	596	N/A	INTRINSIC
low complexity region	636	651	N/A	INTRINSIC
low complexity region	670	678	N/A	INTRINSIC
low complexity region	689	704	N/A	INTRINSIC
low complexity region	709	720	N/A	INTRINSIC
low complexity region	897	915	N/A	INTRINSIC
low complexity region	991	1008	N/A	INTRINSIC
low complexity region	1044	1054	N/A	INTRINSIC
low complexity region	1139	1144	N/A	INTRINSIC
low complexity region	1183	1196	N/A	INTRINSIC
coiled coil region	1258	1688	N/A	INTRINSIC
low complexity region	1873	1896	N/A	INTRINSIC
low complexity region	1920	1934	N/A	INTRINSIC
low complexity region	1942	1961	N/A	INTRINSIC
internal_repeat_2	2003	2053	3.95e-6	PROSPERO
coiled coil region	2069	2170	N/A	INTRINSIC
coiled coil region	2197	2218	N/A	INTRINSIC
coiled coil region	2252	2311	N/A	INTRINSIC
low complexity region	2326	2339	N/A	INTRINSIC
coiled coil region	2341	2367	N/A	INTRINSIC
low complexity region	2380	2389	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124812

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149905

Predicted Effect

probably null
Transcript: ENSMUST00000151569
AA Change: Q438*

SMART Domains

Protein: ENSMUSP00000114426
Gene: ENSMUSG00000038241
AA Change: Q438*

Domain	Start	End	E-Value	Type
Pfam:Rootletin	38	215	1.3e-56	PFAM
low complexity region	228	241	N/A	INTRINSIC
coiled coil region	248	327	N/A	INTRINSIC
internal_repeat_1	444	460	1.16e-14	PROSPERO
internal_repeat_1	465	481	1.16e-14	PROSPERO
low complexity region	495	506	N/A	INTRINSIC
low complexity region	557	580	N/A	INTRINSIC
low complexity region	583	595	N/A	INTRINSIC
low complexity region	635	650	N/A	INTRINSIC
low complexity region	669	677	N/A	INTRINSIC
low complexity region	688	703	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 94.9%

Validation Efficiency

97% (61/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a core centrosomal protein required for centriole-centriole cohesion during interphase of the cell cycle. The encoded protein dissociates from the centrosomes when parental centrioles separate at the beginning of mitosis. The protein associates with and is phosphorylated by NIMA-related kinase 2, which is also associated with the centrosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	C	T	13: 77,192,663	T137I	probably benign	Het
3110082I17Rik	C	T	5: 139,364,031	V88I	possibly damaging	Het
4930453N24Rik	T	A	16: 64,766,614	Q249L	probably damaging	Het
Akap2	C	A	4: 57,856,720	A926E	probably benign	Het
Ap1g2	C	T	14: 55,099,773	V702I	probably benign	Het
Armcx5	G	A	X: 135,746,815	E547K	probably damaging	Het
Asah2	C	A	19: 32,016,728	V406L	probably damaging	Het
Atp8b1	T	C	18: 64,533,587		probably benign	Het
Axl	C	A	7: 25,774,163	R346L	probably benign	Het
Baz1a	G	A	12: 54,941,519	R282*	probably null	Het
Card14	A	G	11: 119,322,827	N200S	probably benign	Het
Cdt1	A	G	8: 122,568,137	T28A	probably benign	Het
Dapk1	C	A	13: 60,718,132	P181Q	probably damaging	Het
Dnah17	C	T	11: 118,070,568		probably benign	Het
Dph7	T	C	2: 24,968,956		probably null	Het
Edc4	A	T	8: 105,889,396	D801V	possibly damaging	Het
Eif4g2	A	G	7: 111,077,223		probably null	Het
Eml2	T	C	7: 19,202,591	L531P	probably damaging	Het
Ephb2	T	C	4: 136,673,365	Y533C	probably benign	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Fsip2	A	G	2: 82,977,533	K1399E	probably benign	Het
Hcls1	A	G	16: 36,962,625	D446G	probably damaging	Het
Hif1a	T	A	12: 73,945,631	N787K	probably damaging	Het
Ints14	T	C	9: 64,964,433	S18P	probably benign	Het
Kalrn	A	T	16: 33,993,670		probably benign	Het
Llgl2	T	A	11: 115,850,267	D502E	probably damaging	Het
Lrwd1	A	G	5: 136,123,500	V570A	probably damaging	Het
Mga	C	G	2: 119,964,466	P2877R	probably damaging	Het
Mvd	T	C	8: 122,436,553	I313V	probably benign	Het
Myo15b	C	A	11: 115,882,913	P270T	probably damaging	Het
Naip1	C	A	13: 100,444,200	V180L	probably benign	Het
Ofd1	T	C	X: 166,435,540		probably benign	Het
Olfr1233	T	A	2: 89,339,985	I106F	probably damaging	Het
Olfr1423	A	T	19: 12,036,565	M59K	possibly damaging	Het
Olfr348	T	A	2: 36,786,693	L56H	probably damaging	Het
Otogl	G	A	10: 107,798,355	P1420S	probably benign	Het
Pcnt	C	T	10: 76,420,316	V697M	probably damaging	Het
Plekha7	A	T	7: 116,154,645	Y702*	probably null	Het
Plxnb3	A	G	X: 73,764,358		probably benign	Het
Ptgis	A	G	2: 167,206,882	F405L	probably damaging	Het
Ptprk	C	T	10: 28,075,136	P19L	probably damaging	Het
Ptprt	A	G	2: 161,812,120	V530A	possibly damaging	Het
Rasgrp4	A	T	7: 29,145,851	Y299F	probably damaging	Het
Slc39a11	T	A	11: 113,523,626		probably null	Het
Slc6a15	T	A	10: 103,404,352	L312*	probably null	Het
Slf1	T	A	13: 77,049,114	M794L	probably benign	Het
Sntg2	G	A	12: 30,257,978	T236I	possibly damaging	Het
Stau1	T	C	2: 166,950,806	Y413C	probably damaging	Het
Syne2	T	G	12: 75,912,353		probably null	Het
Tas2r104	A	T	6: 131,685,202	N181K	probably damaging	Het
Tmem81	G	A	1: 132,507,731	V92I	probably benign	Het
Trap1	A	G	16: 4,060,751		probably benign	Het
Trip12	T	C	1: 84,757,761	E905G	probably damaging	Het
Usp2	C	T	9: 44,092,492	R494*	probably null	Het
Vps13a	G	T	19: 16,652,694	R2692S	probably damaging	Het
Zfhx3	T	C	8: 108,948,539	S2074P	probably benign	Het
Zfhx3	C	G	8: 108,948,967	Y2216*	probably null	Het
Zfp423	A	G	8: 87,782,114	F409S	probably damaging	Het
Zfp472	G	A	17: 32,977,934	E328K	possibly damaging	Het
Zfp619	T	A	7: 39,537,675	M1043K	possibly damaging	Het
Zfp940	T	C	7: 29,846,246	I79V	probably benign	Het

Other mutations in Cep250

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Cep250	APN	2	155991329	missense	probably benign	0.00
IGL01077:Cep250	APN	2	155962134	missense	probably damaging	1.00
IGL01084:Cep250	APN	2	155998393	missense	probably benign	0.00
IGL01400:Cep250	APN	2	155998291	missense	possibly damaging	0.78
IGL01570:Cep250	APN	2	155967663	splice site	probably benign
IGL01583:Cep250	APN	2	155976149	missense	probably damaging	0.99
IGL01590:Cep250	APN	2	155992317	missense	possibly damaging	0.80
IGL01647:Cep250	APN	2	155983376	missense	probably benign	0.02
IGL01959:Cep250	APN	2	155983359	missense	possibly damaging	0.63
IGL02066:Cep250	APN	2	155976521	missense	probably damaging	1.00
IGL02219:Cep250	APN	2	155991594	missense	probably benign	0.26
IGL02322:Cep250	APN	2	155990328	missense	probably damaging	1.00
IGL02728:Cep250	APN	2	155983278	unclassified	probably benign
IGL02955:Cep250	APN	2	155975756	missense	probably benign	0.01
IGL03369:Cep250	APN	2	155990271	missense	probably benign	0.00
R0366:Cep250	UTSW	2	155988401	missense	probably benign	0.00
R0403:Cep250	UTSW	2	155992349	missense	probably damaging	0.99
R0441:Cep250	UTSW	2	155972004	missense	possibly damaging	0.82
R0482:Cep250	UTSW	2	155964974	splice site	probably benign
R0507:Cep250	UTSW	2	155992532	missense	possibly damaging	0.60
R0855:Cep250	UTSW	2	155964111	missense	probably damaging	1.00
R0973:Cep250	UTSW	2	155964289	splice site	probably benign
R1137:Cep250	UTSW	2	155990840	missense	probably benign	0.05
R1270:Cep250	UTSW	2	155990681	missense	probably benign	0.01
R1313:Cep250	UTSW	2	155972079	missense	probably damaging	0.98
R1313:Cep250	UTSW	2	155972079	missense	probably damaging	0.98
R1470:Cep250	UTSW	2	155991075	missense	probably damaging	0.99
R1470:Cep250	UTSW	2	155991075	missense	probably damaging	0.99
R1703:Cep250	UTSW	2	155965546	missense	probably benign	0.23
R1705:Cep250	UTSW	2	155963786	missense	probably damaging	1.00
R1740:Cep250	UTSW	2	155973356	missense	probably damaging	0.99
R1796:Cep250	UTSW	2	155992187	missense	possibly damaging	0.88
R1897:Cep250	UTSW	2	155976095	missense	probably damaging	1.00
R1900:Cep250	UTSW	2	155985374	critical splice donor site	probably null
R1958:Cep250	UTSW	2	155976381	splice site	probably null
R1974:Cep250	UTSW	2	155989504	missense	probably damaging	0.96
R2015:Cep250	UTSW	2	155981453	missense	probably damaging	0.96
R2033:Cep250	UTSW	2	155970892	missense	probably damaging	0.99
R2224:Cep250	UTSW	2	155991817	missense	possibly damaging	0.94
R2266:Cep250	UTSW	2	155976170	missense	probably benign	0.13
R2278:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2332:Cep250	UTSW	2	155990607	missense	probably damaging	1.00
R2364:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2366:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2367:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2385:Cep250	UTSW	2	155974341	missense	probably damaging	1.00
R2830:Cep250	UTSW	2	155983316	missense	probably benign	0.00
R2895:Cep250	UTSW	2	155992122	missense	probably benign	0.00
R2965:Cep250	UTSW	2	155994878	missense	probably benign	0.44
R2966:Cep250	UTSW	2	155994878	missense	probably benign	0.44
R3016:Cep250	UTSW	2	155991288	missense	probably damaging	1.00
R3052:Cep250	UTSW	2	155991048	missense	probably damaging	0.99
R3424:Cep250	UTSW	2	155981461	missense	probably benign	0.02
R3930:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4085:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4087:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4088:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4090:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4110:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4355:Cep250	UTSW	2	155991525	missense	probably damaging	1.00
R4601:Cep250	UTSW	2	155962053	missense	probably benign	0.10
R4721:Cep250	UTSW	2	155970199	missense	probably damaging	1.00
R4995:Cep250	UTSW	2	155988316	missense	probably damaging	1.00
R5053:Cep250	UTSW	2	155962928	missense	possibly damaging	0.77
R5090:Cep250	UTSW	2	155976404	missense	probably damaging	1.00
R5744:Cep250	UTSW	2	155981474	missense	possibly damaging	0.60
R5775:Cep250	UTSW	2	155969374	missense	possibly damaging	0.92
R5986:Cep250	UTSW	2	155979277	missense	probably damaging	1.00
R6112:Cep250	UTSW	2	155994583	missense	possibly damaging	0.95
R6152:Cep250	UTSW	2	155981438	missense	possibly damaging	0.94
R6823:Cep250	UTSW	2	155981459	missense	probably benign	0.02
R6859:Cep250	UTSW	2	155992526	missense	probably benign	0.24
R6900:Cep250	UTSW	2	155996270	critical splice acceptor site	probably null
R7107:Cep250	UTSW	2	155995394	missense	probably benign	0.00
R7131:Cep250	UTSW	2	155965077	missense	probably damaging	1.00
R7178:Cep250	UTSW	2	155973455	nonsense	probably null
R7241:Cep250	UTSW	2	155991552	missense	probably benign	0.20
R7264:Cep250	UTSW	2	155979151	missense	probably damaging	0.99
R7290:Cep250	UTSW	2	155992762	missense	probably benign	0.03
R7367:Cep250	UTSW	2	155969307	missense	probably benign	0.00
R7397:Cep250	UTSW	2	155981411	missense	probably damaging	0.99
R7768:Cep250	UTSW	2	155986009	missense
R7823:Cep250	UTSW	2	155965416	missense	possibly damaging	0.89
R8152:Cep250	UTSW	2	155969307	missense	probably benign	0.00
R8331:Cep250	UTSW	2	155990253	missense	probably damaging	1.00
R8559:Cep250	UTSW	2	155992736	missense	probably damaging	0.99
R8972:Cep250	UTSW	2	155970122	missense	unknown
R8973:Cep250	UTSW	2	155970122	missense	unknown
R8974:Cep250	UTSW	2	155970122	missense	unknown
R8975:Cep250	UTSW	2	155970122	missense	unknown
R8976:Cep250	UTSW	2	155970122	missense	unknown
R9072:Cep250	UTSW	2	155992115	missense	probably benign	0.01
R9123:Cep250	UTSW	2	155970122	missense	unknown
R9127:Cep250	UTSW	2	155970122	missense	unknown
R9128:Cep250	UTSW	2	155970122	missense	unknown
R9167:Cep250	UTSW	2	155987000	missense
R9189:Cep250	UTSW	2	155976430	missense	probably benign	0.00
R9198:Cep250	UTSW	2	155988434	critical splice donor site	probably null
R9227:Cep250	UTSW	2	155970122	missense	unknown
R9228:Cep250	UTSW	2	155970122	missense	unknown
R9292:Cep250	UTSW	2	155990768	missense	probably damaging	0.99
R9516:Cep250	UTSW	2	155991539	missense	probably benign	0.00
R9723:Cep250	UTSW	2	155981417	missense	probably benign	0.00
R9760:Cep250	UTSW	2	155976553	missense	probably benign	0.02
X0061:Cep250	UTSW	2	155961985	missense	probably benign	0.05
Z1177:Cep250	UTSW	2	155976467	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CCTCATGCCACTACATCTGGTGAAC -3'
(R):5'- AAAGCGGCCTTCAGCATCCTTG -3'

Sequencing Primer
(F):5'- TACATCTGGTGAACTCCAAGGTC -3'
(R):5'- ttcctaagaagcctaaggttctg -3'

Posted On

2013-07-11