Incidental Mutation 'R7078:Rsg1'
ID549330
Institutional Source Beutler Lab
Gene Symbol Rsg1
Ensembl Gene ENSMUSG00000073733
Gene NameREM2 and RAB-like small GTPase 1
SynonymsLOC279260, 6330545A04Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.724) question?
Stock #R7078 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location141213956-141226756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141219848 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 180 (Y180F)
Ref Sequence ENSEMBL: ENSMUSP00000095422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097813]
Predicted Effect probably benign
Transcript: ENSMUST00000097813
AA Change: Y180F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000095422
Gene: ENSMUSG00000073733
AA Change: Y180F

DomainStartEndE-ValueType
Pfam:Roc 57 179 7.3e-9 PFAM
Pfam:Ras 57 207 4.3e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit cardiovascular defects including persistent truncus arteriosus and atrioventricular septal defects, as well as polydactyly and micrognathia. Eye defects, hypoplastic lungs and thymus, and tracheoesophageal anomalies may be also present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,410,709 N210S probably benign Het
Acaca G A 11: 84,263,312 R953Q possibly damaging Het
Aldh1a1 A T 19: 20,602,070 H20L probably benign Het
Ankrd52 T A 10: 128,383,657 C487S probably benign Het
Ap1s3 T C 1: 79,625,128 E54G probably benign Het
Arglu1 A C 8: 8,667,361 M236R probably benign Het
Baz1b T A 5: 135,217,439 F581I probably benign Het
Bbox1 T G 2: 110,292,539 D135A probably benign Het
Bcl2l14 T A 6: 134,423,823 V69E probably damaging Het
Brinp3 C T 1: 146,514,889 Q58* probably null Het
Ccnb1ip1 T A 14: 50,792,267 K113* probably null Het
Cep128 T C 12: 91,234,104 I830M probably damaging Het
Ces2f C T 8: 104,954,652 T541I probably damaging Het
Chsy3 C A 18: 59,176,077 P134Q possibly damaging Het
Cobl T G 11: 12,378,271 T112P probably damaging Het
Dcc T A 18: 71,547,398 K589I probably benign Het
Depdc1b T A 13: 108,386,971 I460K possibly damaging Het
Dlst T C 12: 85,110,931 F12S probably benign Het
Dnah1 G C 14: 31,297,110 F1342L probably damaging Het
Dtnb A G 12: 3,748,480 Q438R possibly damaging Het
Dusp4 C A 8: 34,807,911 S61R probably damaging Het
E130308A19Rik A G 4: 59,737,688 Y433C probably damaging Het
Ebf2 T C 14: 67,423,958 S512P probably benign Het
Eya1 C T 1: 14,231,412 probably null Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Fzr1 T A 10: 81,368,629 D379V probably damaging Het
Gk2 T A 5: 97,456,336 E214D probably benign Het
Gm10837 C G 14: 122,490,730 A6G unknown Het
Gmnc A T 16: 26,960,522 V251E probably benign Het
Golga3 A G 5: 110,193,087 Q549R probably damaging Het
Gsdmd T G 15: 75,864,355 V111G probably damaging Het
Gtf3c1 T C 7: 125,645,742 T1707A possibly damaging Het
Gucy2c C T 6: 136,697,939 V1049M probably benign Het
Gucy2g A G 19: 55,241,151 V29A probably damaging Het
Hecw1 A T 13: 14,434,459 M1K probably null Het
Hmcn1 T C 1: 150,860,367 D117G probably damaging Het
Ifnab T A 4: 88,691,113 T39S possibly damaging Het
Lcorl A G 5: 45,747,224 Y171H probably damaging Het
Ly6g6c C T 17: 35,069,461 P103L probably damaging Het
Macf1 T G 4: 123,432,143 E5189A probably damaging Het
Mapkap1 A G 2: 34,563,139 E348G probably damaging Het
Med25 G T 7: 44,884,901 A280D probably damaging Het
Mep1b C A 18: 21,100,051 A703E probably benign Het
Morn5 T A 2: 36,054,978 N71K probably benign Het
Mtmr10 T A 7: 64,320,627 Y373N possibly damaging Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Ncbp1 G C 4: 46,155,756 V302L probably benign Het
Notch4 A G 17: 34,582,546 T1123A possibly damaging Het
Nudt18 T A 14: 70,579,012 M88K possibly damaging Het
Olfr1452-ps1 A T 19: 13,016,733 D170V possibly damaging Het
Olfr212 T A 6: 116,516,671 L298Q probably damaging Het
Olfr361 A G 2: 37,085,596 S51P possibly damaging Het
Olfr967 A T 9: 39,750,491 Y35F possibly damaging Het
Pdcd6ip T C 9: 113,659,885 N694S probably benign Het
Pecam1 T A 11: 106,688,947 T430S probably benign Het
Plaa T G 4: 94,574,051 T530P probably benign Het
Ppfia3 G T 7: 45,360,595 Q95K probably damaging Het
Ppp4r2 T C 6: 100,866,313 S331P probably benign Het
Prg4 T C 1: 150,458,263 T117A possibly damaging Het
Prrc2b A T 2: 32,213,519 D1003V probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rasef T C 4: 73,780,389 I12V probably benign Het
Robo2 T G 16: 74,352,616 Y108S probably damaging Het
Rp1 T A 1: 4,206,791 E762V unknown Het
Rsrc1 T C 3: 66,994,654 S46P unknown Het
Rttn A T 18: 89,009,422 T554S probably benign Het
Sall3 C T 18: 80,974,099 V205M probably damaging Het
Scn3a C A 2: 65,497,600 V849L probably damaging Het
Sec23a A G 12: 58,992,283 C277R probably benign Het
Sf3b3 C T 8: 110,813,007 A1075T possibly damaging Het
Sfxn5 T C 6: 85,332,384 D113G unknown Het
Slc22a22 C T 15: 57,263,480 M64I probably benign Het
Slc5a11 C T 7: 123,258,446 P253S probably damaging Het
Smarcd3 A G 5: 24,593,069 F449S probably damaging Het
Sspo C T 6: 48,460,379 T1357M probably damaging Het
Styx C T 14: 45,372,416 T179I probably benign Het
Syt7 A T 19: 10,435,599 T297S probably benign Het
Tbx19 T A 1: 165,160,566 probably benign Het
Tg T A 15: 66,673,543 V149E probably damaging Het
Tgfbr3l T A 8: 4,249,238 L35Q probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmem219 T A 7: 126,891,803 T161S probably damaging Het
Tox2 T A 2: 163,320,581 L68H Het
Trim5 T A 7: 104,278,474 D153V possibly damaging Het
Ttn T C 2: 76,750,307 Y23414C probably damaging Het
Ttn A T 2: 76,751,809 N22913K probably damaging Het
Ubr2 A C 17: 46,955,853 M1124R possibly damaging Het
Vmn2r75 A G 7: 86,166,360 S99P probably damaging Het
Wdr83 T C 8: 85,076,051 D219G probably damaging Het
Wdr90 C T 17: 25,849,649 V1285M probably damaging Het
Zmynd15 A T 11: 70,460,755 L62F probably damaging Het
Other mutations in Rsg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Rsg1 APN 4 141218653 missense probably benign 0.01
R0488:Rsg1 UTSW 4 141214401 missense probably benign 0.05
R0967:Rsg1 UTSW 4 141219851 missense probably benign 0.01
R1339:Rsg1 UTSW 4 141218548 missense probably damaging 1.00
R1460:Rsg1 UTSW 4 141218212 missense probably damaging 0.97
R3826:Rsg1 UTSW 4 141218589 missense probably damaging 1.00
R3828:Rsg1 UTSW 4 141218589 missense probably damaging 1.00
R3829:Rsg1 UTSW 4 141218589 missense probably damaging 1.00
R3830:Rsg1 UTSW 4 141218589 missense probably damaging 1.00
R5076:Rsg1 UTSW 4 141217385 missense probably benign 0.00
R5242:Rsg1 UTSW 4 141219847 missense probably damaging 1.00
R5527:Rsg1 UTSW 4 141219992 missense probably damaging 1.00
R5610:Rsg1 UTSW 4 141219866 missense probably benign 0.00
R5677:Rsg1 UTSW 4 141219866 missense probably benign 0.00
R6049:Rsg1 UTSW 4 141218162 missense probably benign 0.18
R6543:Rsg1 UTSW 4 141217288 missense probably benign
R7483:Rsg1 UTSW 4 141219842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCTGGCAAAGTACCTGTC -3'
(R):5'- GATGTTGTCACCGTTCAGCC -3'

Sequencing Primer
(F):5'- AAAGTACCTGTCCCCCTGTGAG -3'
(R):5'- GTGCCACAACTGTTCTGCAAG -3'
Posted On2019-05-15